This metadata record was created in error and a DOI assigned to it before the error was noticed. The correct metadata record is available here: https://data.aad.gov.au/metadata/records/AAS_4015_Krill_Gonad_Transcriptome with the DOI doi:10.26179/5cd3c8fec9ad8.

RNA was extracted from pooled gonad tissues and tails of five sexually mature males and females, respectively, originating from the krill aquarium at the AAD in Tasmania, Australia. For RNA extractions, RNeasy mini kits (QIAGEN) were used and total RNA (8 micrograms each) was sent to Geneworks, South Australia (www.geneworks.com.au), for Illumina TruSeq 75 bp paired-end sequencing in two technical replica. Reads Yield Total Yield Krill_Male_sex_a_read1_sequence.txt 8,120,993 609,074,475 bases 1,218,148,950 bases Krill_Male_sex_a_read2_sequence.txt 8,120,993 609,074,475 bases Krill_Male_sex_b_read1_sequence.txt 10,465,586 784,918,950 bases 1,569,837,900 bases Krill_Male_sex_b_read2_sequence.txt 10,465,586 784,918,950 bases Krill_Male_tissue_a_read1_sequence.txt 7,867,804 590,085,300 bases 1,180,170,600 bases Krill_Male_tissue_a_read2_sequence.txt 7,867,804 590,085,300 bases Krill_Male_tissue_b_read1_sequence.txt 10,956,251 821,718,825 bases 1,793,118,450 bases Krill_Male_tissue_b_read2_sequence.txt 10,956,251 821,718,825 bases Krill_Female_sex_read1a_sequence.txt 29,447,654 2,208,574,050 bases 4,417,148,100 bases Krill_Female_sex_read2a_sequence.txt 29,447,654 2,208,574,050 bases Krill_Female_sex_read1b_sequence.txt 18,223,515 1,366,763,625 bases 2,733,527,250 bases Krill_Female_sex_read2b_sequence.txt 18,223,515 1,366,763,625 bases The insert size for these libraries is approx 160bp.

Krill-associated bacterial communities characterised by high-throughput DNA sequencing of the 16S ribosomal RNA gene. The data is decribed in 'Clarke LJ, Suter L, King R, Bissett A and Deagle BE (2019) Antarctic Krill Are Reservoirs for Distinct Southern Ocean Microbial Communities. Front. Microbiol. 9:3226. doi: 10.3389/fmicb.2018.03226' available here: https://www.frontiersin.org/articles/10.3389/fmicb.2018.03226/full

Population connectivity and gene flow in near shore Antarctic Echinoids (Sterechinus neumayeri, Abatus nimrodi and Abatus ingens) was investigated in East Antarctica. This data set consists of microsatellite genotype data from 11 novel loci and mitochondrial DNA sequences from two gene region, COI and 16S. In addition, to determine if changes in temperature and salinity impacted fertilisation success in S. neumayeri, and to determine the appropriate sperm to egg ratio for this type of experiment, a fertilisation experiment was completed using various combinations of temperature, salinity and sperm to egg ratio. Samples were collected near two Australian Antarctic research stations, Casey and Davis, during the 08/09 and 09/10 summer field seasons. To generate the microsatellite data set, a total of 545 adults, nuemayeri and 26 echinoplutei were collected. Spatial replication was achieved by comparing adult populations between two regions (Casey and Davis). These two regions are separated by approximately 1400 km. Sampling in the Casey region was done at two locations 9 km apart and in the Davis region at five locations separated by 5 - 30 km. Within each location 25-50 individuals were collected from up to three sites approximately 0.5 km apart. Within each site, all individuals were collected within an area less than 50 m2. Adult urchins were collected by dip nets, snorkel or scuba depending on location. Echinoplutei were collected from the water column in two locations in the Davis region using a purpose built plankton net. DNA was extracted using QiagenDNeasy Blood and Tissue extraction kits as per the manufacturer's protocols. PCR amplification was carried out in four multiplex reactions and analysis of the PCR product was carried out on a CEQ 8000 (Beckman Coulter) automated sequencer by capillary separation, and alleles scored as fragment size using CEQ 8000 Genetic Analysis System software (ver. 8.0). Data available: Data consists of 571 individual genotypes at 11 loci in an excel spreadsheet following the GenAlEx v 6.41 layout. Sites from the Davis region are; Old Wallow 1 (OW1), Old Wallow 2 (OW2), Boyd Island (BO1), Ellis Fjord 1 (EL1), Ellis Fjord 2 (EL2), Ellis Fjord 3 (EL3), Trigwell Island 1 (TR1), Trigwell Island 2 (TR2), Trigwell Island 3 (TR3), Zappit Point 1 (ZP1), Zappit Point 2 (ZP2), Zappit Point 3 (ZP3). Sites from the Casey region are; Browning Peninsula 1 (CB1), Browning Peninsula 2 (CB2), Browning Peninsula 3 (CB3), Sparkes Bay 1 (CS1), Sparkes Bay 2 (CS2).Echinoplutei samples are Hawker Island (D1); Kazak Island 1 (K1); Kazak Island 2 (K2) Data is coded as fragment length, with a zero value representing no data. To generate the mtDNA sequence data, a total of 24 S. neumayeri individuals were sequenced for the COI gene region with two haplotypes found. For the 16S gene region, 25 individuals were sequenced with three haplotypes founds. For Abatusingens, 51 individuals were sequenced with six CO1 haplotypes and five 16S haplotypes. For Abatus nimrodi (n = 48) there were two CO1 haplotypes and eight 16S haplotypes. In addition, eight A. shackeltoni, four A. philippii and one A. cavernosus sample were included from the Davis region. Data available: data are available in four FASTA text format files, one for Abatus COI data, one forAbatus 16S data, one for Sterechinus COI data. Individuals are coded with the first two letters representing species (SN = S. neumayeri, AN = A. nimrodi, AI = A. ingens, AS = A. shackletoni, AC= A. cavernosus) the next two representing gene region (CO = COI, 16 = 16S) and either three or four more digits for Davis region samples or five digits beginning with 41 for Casey region samples. To generate the fertilisation data set, S. neumayeri were collected from Ellis Fjord prior to ice breakout. A total of 12 individuals were screened for the fertilisation experiment, seven males and five females to ensure a suitable cross where greater than 90% fertilisation success was achievable. Sperm were activated with FSW at -1.8 degrees C and sperm concentration determined using a haemocytometer. Three temperature treatments, (-1.8 degrees C, 1 degrees C and 3 degrees C), three salinity treatments (35ppt, 30ppt and 25ppt), and five sperm to egg ratios (50:1, 100:1, 500:1, 1500:1 and 2500:1) were used during fertilisation, with four replicates at each temperature:salinity:sperm to egg ratio combination. After 30 min, three to five drops of 10% formalin were added to each vial to fix eggs and to prevent further fertilisation from occurring. To determine percentage fertilisation, the first 100 eggs encountered from each vial were scored as either fertilised or unfertilised based on the presence or absence of an elevated fertilisation membrane. Data available: Data are available as an excel file, with three spreadsheets, one for each temperature treatment. Each spreadsheet consists of three tables, one for each salinity treatment. Each salinity treatment table consists of five columns. From left to right these are; sperm : egg ratio - Sperm to egg ratio, rep. No. - replicate number, Fert. - number of fertilised eggs counted Unfert. - number of unfertilised eggs counted Mean- mean number of fertilised eggs counted

In March 2018, 23 environmental DNA (eDNA) samples (2 L of filtered seawater) were collected between Hobart, Tasmania and subantarctic Macquarie Island. These samples were processed using six different genetic metabarcoding markers targeting different taxonomic groups within the metazoan clade: A broad cytochrome c oxidase subunit I (COI) marker targeting all metazoans, and five different 16S markers targeting fish, cephalopods and crustaceans (one degenerate marker), fish (two markers of different lengths), cephalopods (one marker) and crustaceans (one marker). The aim of this study was to identify an ideal set of molecular markers to identify as many metazoan species as possible from small environmental samples, with a particular focus on vertebrates, crustaceans and cephalopods. The data and methods are described in the word file "V4 2018 eDNA group specific markers.docx", results are summarised in the excel file "Marker.detection.xlsx" and additional sample information is in the excel files "2018_11_07_eDNA-sample-info.xls" and "sample.map.csv". Each genetic marker used in this study has its own folder, containing the raw FASTQ sequencing data, the processed FASTA sequencing data, the bioinformatics processing pipeline, the zOTU fasta file, BLAST output, MEGAN output and curated zOTU table. For further explanations please refer to the word file "V4 2018 eDNA group specific markers.docx".

June 2018 Adélie penguin scats were collected from Signy Island (South Orkney Islands) during crèche (December/January) 2014/15 and 2015/16 and stored in 80% Ethanol. DNA was extracted from ~30 mg of faecal material using a Promega ‘Maxwell 16' instrument and a Maxwell® 16 Tissue DNA kit. A total of 450 samples were analysed: 30 extractions per week for 2015 and 60 per week for samples collected in 2016. Three DNA markers providing different taxonomic information were amplified from penguin faecal DNA. First, ALL faecal DNA samples were characterised using a highly conserved metazoan primer set that amplifies a region of the nuclear 18S gene. In addition, a subset of faecal samples from each year were also characterised with two other primer pairs that amplify a region of the mtDNA 16S gene to allow species-level identification for most fish (16S_Fish) and krill (16S_Krill) species respectively. During amplification of markers, the products were tagged with a unique pair of index primers allowing samples to be pooled and sequenced (2x150bp) on a MiSeq high-throughput DNA sequencer. - See Adelie Pengiun Diet CCAMLR paper for all of the primer/PCR details - See BAS Adelie 18s Krill and Fish subset excel spreadsheet for sample details. - See BAS Adelie 18s ALL samples fastq for 18s fastq files - See BAS Adelie 16s Krill subset fastq for 16s krill fastq files - See BAS Adelie Fish subset fastq for 16s fish fastq files ##################################################################################### November 2018 In addition we also amplified all 450 samples with the 16S_Fish marker. - See Adelie Experiment Details 16s Fish for sample details, plate layout, first and second round PCR and miseq sheet. - See BAS Adelie Fish ALL Samples fastq for 16s fish fastq files

These spreadsheets provide the proportions of prey DNA sequences in the scats of Adelie penguins at Bechervaise Island and Whitney Point in East Antarctica. Samples were collected during two stages of the breeding season: mid brood guard (Bechervaise Island-January 4-6th 2013, Whitney Point 23- 28th December 2012) and mid creche (23-26th January 2013). Scat samples were collected from breeding birds, chicks and non-breeders at Bechervaise Island and breeding birds and chicks at Whitney Point. 'Breeders' were identified as individuals brooding or provisioning a chick, whereas 'non-breeders' were usually pairs that had reoccupied the colony and were building new practice nests with no chick present. Non-breeders in the colony include immature birds that have not yet bred and mature birds of breeding age that did not breed in a particular season (e.g. no partner or insufficient body condition) DNA from each sample was extracted and sequenced as per the protocols in the following paper: Jarman, S.N., McInnes, J.C., Faux, C., Polanowski, A.M., Marthick, J., Deagle, B.E., Southwell, C. and Emmerson, L. 2013 Adelie penguin population diet monitoring by analysis of food DNA in scats. PLoS One 8, e82227. (doi:10.1371/journal.pone.0082227). The Raw Data spreadsheet contains the proportion of each prey group of each individual sample, plus the total sequence count of prey items. Only samples with greater than 100 prey sequences are included in the dataset. The summary datasheet contains only prey taxa which contained greater than 2% of the proportion of sequences. Analysis of these data have been published in: McInnes JC, Emmerson L, Southwell C, Faux C, Jarman SN. (2016) Simultaneous DNA-based diet analysis of breeding, non-breeding and chick Adelie Penguins http://dx.doi.org/10.1098/rsos.150443

This metadata record contains an Excel spreadsheet with Operational Taxonomic Units (OTUs) gained from Eukaryotic 18S rDNA PCR amplification and high-throughput sequencing of samples from Biofilm slides deployed as part of the antFOCE experiment in the austral summer of 2014/15 at Casey station, East Antarctica. Refer to antFOCE report section 4.5.3 for deployment, sampling and analysis details. https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 Sampling design 2 trays of 8 horizontal standard glass microscope slides (72 x 25 mm) per chamber. Four of the glass slides were scored with a diamond pencil approximately 18 mm from the right hand end of the slide and deployed scored side up. The remaining four slides were unmodified. Slides were sampled at: - Tmid - one tray per chamber / open plot. The sampled try was repopulated with fresh slides and redeployed - Tend – 2 slides trays per chamber / open plot. Sampling procedure After 31 days deployment, 1 slide tray per chamber / open plot was sampled. At Tend both trays in each chamber / open plot were sampled. To minimize disturbance while being raised to the surface, each tray was removed from the tray holder by divers and placed in a seawater filled container with a lid. On the surface, slides were removed from the tray using ethanol sterilized forceps. The four unscoured slides per chamber / open plot were placed in a plastic microscope slide holder with a sealable lid. The scoured slides were placed individually in 70 ml plastic sample jars. Lab procedure - Casey The slide holder (4 unscoured slides) from each chamber / open plot was frozen at -20C immediately upon return to the lab. The scoured slides were preserved in sea water containing 1% final concentration glutaraldehyde in separate jars. Preservation Issue: Scoured slides were not refrigerated, either at Casey, during RTA or in Kingston before the 26th Nov 2015, when they were transferred to the 4C Cold Store. antFOCE Background The antFOCE experimental system was deployed in O’Brien Bay, approximately 5 kilometres south of Casey station, East Antarctica, in the austral summer of 2014/15. Surface and sub-surface (in water below the sea ice) infrastructure allowed controlled manipulation of seawater pH levels (reduced by 0.4 pH units below ambient) in 2 chambers placed on the sea floor over natural benthic communities. Two control chambers (no pH manipulation) and two open plots (no chambers, no pH manipulation) were also sampled to compare to the pH manipulated (acidified) treatment chambers. Details of the antFOCE experiment can be found in the report – "antFOCE 2014/15 – Experimental System, Deployment, Sampling and Analysis". This report and a diagram indicating how the various antFOCE data sets relate to each other are available at: https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 AntFOCE biofilm DNA methods Laurence Clarke, Shane Powell, Bruce Deagle DNA extraction The biofilm was removed from the top of each slide with a cotton swab and DNA extracted directly from the swab using the MoBio PowerBiofilm DNA isolation kit following the manufacturer’s protocol. Extraction blanks were extracted in parallel to detect contamination. Eukaryotic 18S rDNA PCR amplification and high-throughput sequencing DNA extracts were PCR-amplified in triplicate with primers designed to amplify 140-170 bp of eukaryotic 18S ribosomal DNA (Jarman et al. 2013). The forward primer was modified to improve amplification of protists. Table 1. First and second round primers, including MID tags (Xs). ILF_ProSSU3'F_X TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG XXXXXX CACCGCCCGTCGCWMCTACCG ILR_SSU3'R_Y GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG XXXXXX GGTTCACCTACGGAAACCTTGTTACG msqFX AATGATACGGCGACCACCGAGATCTACAC XXXXXXXXXX TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG msqRY CAAGCAGAAGACGGCATACGAGAT XXXXXXXXXX GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG PCR amplifications were performed in two rounds, the first to amplify the 18S region and add sample-specific multiplex-identifier (MID) tags and Illumina sequencing primers, the second to add the P5 and P7 sequencing adapters and additional MIDs. Each reaction mix for the first PCR contained 0.1 µM each of forward and reverse primer, 0.2 µg/µL BSA, 0.2 U Phusion DNA polymerase in 1 x Phusion Master Mix (New England Biolabs, Ipswich, MA, USA) and 1 micro L DNA extract in a total reaction volume of 10 micro L. PCR thermal cycling conditions were initial denaturation at 98 degrees C for 30 secs, followed by 25 cycles of 98 degrees C for 5 secs, 67 degrees C for 20 secs and 72 degrees C for 20 secs, with a final extension at 72 degrees C for 5 min. Replicate PCR products were pooled then diluted 1:10 and Illumina sequencing adapters added in a second round of PCR using the same reaction mix and thermal cycling conditions as the first round, except the concentration of BSA was halved (0.1 micro g/micro L), and the number of cycles was reduced to 10 with an annealing temperature of 55 degrees C. Products from each round of PCR were visualized on 2% agarose gels. Second round PCR products were pooled in equimolar ratios based on band intensity. The pooled products were purified using Agencourt AMPure XP beads (Beckman Coulter, Brea, CA, USA) and the concentration of the library measured using the Qubit dsDNA HS assay on a QUBIT 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA). The pool was diluted to 2 nM and paired-end reads generated on a MiSeq (Illumina, San Diego, CA, USA) with MiSeq Reagent Nano kit vs (300-cycles). Bacterial 16S rDNA PCR amplification and high-throughput sequencing Bioinformatics Reads were sorted by sample-specific MIDs added in the second round PCR using the MiSeq Reporter software. Fastq reads were merged using the -fastq_mergepairs command in USEARCH v8.0.1623 (Edgar 2010). Merged reads were sorted by "internal" 6 bp MID tags, and locus-specific primers trimmed with custom R scripts using the ShortRead package (Morgan et al. 2009), with only reads containing perfect matches to the expected MIDs and primers retained. Reads for all samples were dereplicated and global singletons discarded (-derep_fulllength -minuniquesize 2), and clustered into OTUs with the UPARSE algorithm (Edgar 2013) using the '-cluster_otus' command. Potentially chimeric reads were also discarded during this step. Reads for each sample were then assigned to OTUs (-usearch_global -id .97), and an OTU table generated using a custom R script. Taxonomy was assigned to each OTU using MEGAN version 5.10.5 (Huson et al. 2011) based on 50 hits per OTU generated by BLASTN searches against the NCBI 'nt' database (downloaded August 2015). Default LCA parameters were used, except Min support = 1, Min score = 100, Top percent = 10. Alpha and beta-diversity analyses were performed based on a rarefied OTU table with QIIME v1.8.0 (alpha_rarefaction.py, beta_diversity_through_plots.py, Caporaso et al. 2010). References Caporaso JG, Kuczynski J, Stombaugh J, et al. (2010) QIIME allows analysis of high-throughput community sequencing data. Nature Methods 7, 335-336. Huson DH, Mitra S, Ruscheweyh HJ, Weber N, Schuster SC (2011) Integrative analysis of environmental sequences using MEGAN4. Genome Research 21, 1552-1560. Jarman SN, McInnes JC, Faux C, et al. (2013) Adelie penguin population diet monitoring by analysis of food DNA in scats. PLoS One 8, e82227.

Purpose of experiments: Sequence data obtained to determine community structure of pack sea-ice microbial communities and whether it is effected by exposures to elevated CO2 levels. Summary of Methods: Cells in sea-ice brines were filtered onto 0.2 micron filters and material extracted using the MoBio Water DNA extraction kit. The DNA was analysed by Research and Testing Laboratories Inc. (Lubbock, Texas, USA) via 454 pyrosequencing. The bacteria were analysed using primers set 10F-519R, which targets 16S rRNA genes. 16S rRNA genes associated with chloroplast and mitochondria are included in this dataset but represent a minority of sequences in most samples. Eukaryotes were analysed using primers set 550F-1055R, which targets 18S rRNA genes. The 454 pyrosequencing analysis with the Titanium GS FLX+ kit used generates on average 3000 reads incorporating custom pyrotags for later stages of the data analysis. The specific steps used for subsequent data analysis are described in the attached PDF file (Data_Analysis_Methodology.PDF). This output was further refined by first determining consensus sequences at the 98% similarity level using Weizhong Li’s online software site CD-HIT (http://weizhongli-lab.org/cd-hit/) Reference: Niu B, Fu L, Sun S, Li W. 2010. Artificial and natural duplicates in pyrosequencing reads of metagenomic data. BMC Bioinformatics 1:187 doi:10.1186/1471-2105-11-187. The consensus sequences were then checked for errors, manually curated, and aligned against closest matching sequences obtained from the NCBI database (www.ncbi.nlm.nih.gov) to finally obtained a list of consensus operational taxonomic entities and the number of reads obtained for each samples analysed. File: SIPEXII_DNA_Sample_information.xlsx provides sampling and analysis information for the detailed results in the other two files File: SCIPEXII__sea_ice_bacteria_OTUs.xlsx contains information on the number of 16S rRNA reads in bacteria Phylum/Class and OTUs File: SCIPEXII_sea_ice_brines_eukaryote_community_OTU_data.xlsx contains information on the number of 16S rRNA reads in eukaryotic microbes: Phylum/Order/Closest taxon and OTUs

The present data set corresponds to the genotypes for seven microsatellite markers for three Antarctic sea urchin species of the genus Abatus. Sea urchin individuals were collected in five sites separated by up to 5 km in the near-shore area surrounding Davis Station in the Vestfold Hills Region, East Antarctica. For each microsatellite loci, the size of each allele was scored (in base pairs) using the CEQ 8000 Genetic Analysis System software v.8.0. Fragments were separated on an automated sequencer (CEQ 8000, Beckman Coulter) in the Central Science Laboratory at University of Tasmania.