ADS > Automated DNA Sequencer
Type of resources
Topics
Keywords
Contact for the resource
Provided by
-
This metadata record was created in error and a DOI assigned to it before the error was noticed. The correct metadata record is available here: https://data.aad.gov.au/metadata/records/AAS_4015_Krill_Gonad_Transcriptome with the DOI doi:10.26179/5cd3c8fec9ad8.
-
Population connectivity and gene flow in near shore Antarctic Echinoids (Sterechinus neumayeri, Abatus nimrodi and Abatus ingens) was investigated in East Antarctica. This data set consists of microsatellite genotype data from 11 novel loci and mitochondrial DNA sequences from two gene region, COI and 16S. In addition, to determine if changes in temperature and salinity impacted fertilisation success in S. neumayeri, and to determine the appropriate sperm to egg ratio for this type of experiment, a fertilisation experiment was completed using various combinations of temperature, salinity and sperm to egg ratio. Samples were collected near two Australian Antarctic research stations, Casey and Davis, during the 08/09 and 09/10 summer field seasons. To generate the microsatellite data set, a total of 545 adults, nuemayeri and 26 echinoplutei were collected. Spatial replication was achieved by comparing adult populations between two regions (Casey and Davis). These two regions are separated by approximately 1400 km. Sampling in the Casey region was done at two locations 9 km apart and in the Davis region at five locations separated by 5 - 30 km. Within each location 25-50 individuals were collected from up to three sites approximately 0.5 km apart. Within each site, all individuals were collected within an area less than 50 m2. Adult urchins were collected by dip nets, snorkel or scuba depending on location. Echinoplutei were collected from the water column in two locations in the Davis region using a purpose built plankton net. DNA was extracted using QiagenDNeasy Blood and Tissue extraction kits as per the manufacturer's protocols. PCR amplification was carried out in four multiplex reactions and analysis of the PCR product was carried out on a CEQ 8000 (Beckman Coulter) automated sequencer by capillary separation, and alleles scored as fragment size using CEQ 8000 Genetic Analysis System software (ver. 8.0). Data available: Data consists of 571 individual genotypes at 11 loci in an excel spreadsheet following the GenAlEx v 6.41 layout. Sites from the Davis region are; Old Wallow 1 (OW1), Old Wallow 2 (OW2), Boyd Island (BO1), Ellis Fjord 1 (EL1), Ellis Fjord 2 (EL2), Ellis Fjord 3 (EL3), Trigwell Island 1 (TR1), Trigwell Island 2 (TR2), Trigwell Island 3 (TR3), Zappit Point 1 (ZP1), Zappit Point 2 (ZP2), Zappit Point 3 (ZP3). Sites from the Casey region are; Browning Peninsula 1 (CB1), Browning Peninsula 2 (CB2), Browning Peninsula 3 (CB3), Sparkes Bay 1 (CS1), Sparkes Bay 2 (CS2).Echinoplutei samples are Hawker Island (D1); Kazak Island 1 (K1); Kazak Island 2 (K2) Data is coded as fragment length, with a zero value representing no data. To generate the mtDNA sequence data, a total of 24 S. neumayeri individuals were sequenced for the COI gene region with two haplotypes found. For the 16S gene region, 25 individuals were sequenced with three haplotypes founds. For Abatusingens, 51 individuals were sequenced with six CO1 haplotypes and five 16S haplotypes. For Abatus nimrodi (n = 48) there were two CO1 haplotypes and eight 16S haplotypes. In addition, eight A. shackeltoni, four A. philippii and one A. cavernosus sample were included from the Davis region. Data available: data are available in four FASTA text format files, one for Abatus COI data, one forAbatus 16S data, one for Sterechinus COI data. Individuals are coded with the first two letters representing species (SN = S. neumayeri, AN = A. nimrodi, AI = A. ingens, AS = A. shackletoni, AC= A. cavernosus) the next two representing gene region (CO = COI, 16 = 16S) and either three or four more digits for Davis region samples or five digits beginning with 41 for Casey region samples. To generate the fertilisation data set, S. neumayeri were collected from Ellis Fjord prior to ice breakout. A total of 12 individuals were screened for the fertilisation experiment, seven males and five females to ensure a suitable cross where greater than 90% fertilisation success was achievable. Sperm were activated with FSW at -1.8 degrees C and sperm concentration determined using a haemocytometer. Three temperature treatments, (-1.8 degrees C, 1 degrees C and 3 degrees C), three salinity treatments (35ppt, 30ppt and 25ppt), and five sperm to egg ratios (50:1, 100:1, 500:1, 1500:1 and 2500:1) were used during fertilisation, with four replicates at each temperature:salinity:sperm to egg ratio combination. After 30 min, three to five drops of 10% formalin were added to each vial to fix eggs and to prevent further fertilisation from occurring. To determine percentage fertilisation, the first 100 eggs encountered from each vial were scored as either fertilised or unfertilised based on the presence or absence of an elevated fertilisation membrane. Data available: Data are available as an excel file, with three spreadsheets, one for each temperature treatment. Each spreadsheet consists of three tables, one for each salinity treatment. Each salinity treatment table consists of five columns. From left to right these are; sperm : egg ratio - Sperm to egg ratio, rep. No. - replicate number, Fert. - number of fertilised eggs counted Unfert. - number of unfertilised eggs counted Mean- mean number of fertilised eggs counted
-
This metadata record contains an Excel spreadsheet with Operational Taxonomic Units (OTUs) gained from Eukaryotic 18S rDNA PCR amplification and high-throughput sequencing of samples from Biofilm slides deployed as part of the antFOCE experiment in the austral summer of 2014/15 at Casey station, East Antarctica. Refer to antFOCE report section 4.5.3 for deployment, sampling and analysis details. https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 Sampling design 2 trays of 8 horizontal standard glass microscope slides (72 x 25 mm) per chamber. Four of the glass slides were scored with a diamond pencil approximately 18 mm from the right hand end of the slide and deployed scored side up. The remaining four slides were unmodified. Slides were sampled at: - Tmid - one tray per chamber / open plot. The sampled try was repopulated with fresh slides and redeployed - Tend – 2 slides trays per chamber / open plot. Sampling procedure After 31 days deployment, 1 slide tray per chamber / open plot was sampled. At Tend both trays in each chamber / open plot were sampled. To minimize disturbance while being raised to the surface, each tray was removed from the tray holder by divers and placed in a seawater filled container with a lid. On the surface, slides were removed from the tray using ethanol sterilized forceps. The four unscoured slides per chamber / open plot were placed in a plastic microscope slide holder with a sealable lid. The scoured slides were placed individually in 70 ml plastic sample jars. Lab procedure - Casey The slide holder (4 unscoured slides) from each chamber / open plot was frozen at -20C immediately upon return to the lab. The scoured slides were preserved in sea water containing 1% final concentration glutaraldehyde in separate jars. Preservation Issue: Scoured slides were not refrigerated, either at Casey, during RTA or in Kingston before the 26th Nov 2015, when they were transferred to the 4C Cold Store. antFOCE Background The antFOCE experimental system was deployed in O’Brien Bay, approximately 5 kilometres south of Casey station, East Antarctica, in the austral summer of 2014/15. Surface and sub-surface (in water below the sea ice) infrastructure allowed controlled manipulation of seawater pH levels (reduced by 0.4 pH units below ambient) in 2 chambers placed on the sea floor over natural benthic communities. Two control chambers (no pH manipulation) and two open plots (no chambers, no pH manipulation) were also sampled to compare to the pH manipulated (acidified) treatment chambers. Details of the antFOCE experiment can be found in the report – "antFOCE 2014/15 – Experimental System, Deployment, Sampling and Analysis". This report and a diagram indicating how the various antFOCE data sets relate to each other are available at: https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 AntFOCE biofilm DNA methods Laurence Clarke, Shane Powell, Bruce Deagle DNA extraction The biofilm was removed from the top of each slide with a cotton swab and DNA extracted directly from the swab using the MoBio PowerBiofilm DNA isolation kit following the manufacturer’s protocol. Extraction blanks were extracted in parallel to detect contamination. Eukaryotic 18S rDNA PCR amplification and high-throughput sequencing DNA extracts were PCR-amplified in triplicate with primers designed to amplify 140-170 bp of eukaryotic 18S ribosomal DNA (Jarman et al. 2013). The forward primer was modified to improve amplification of protists. Table 1. First and second round primers, including MID tags (Xs). ILF_ProSSU3'F_X TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG XXXXXX CACCGCCCGTCGCWMCTACCG ILR_SSU3'R_Y GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG XXXXXX GGTTCACCTACGGAAACCTTGTTACG msqFX AATGATACGGCGACCACCGAGATCTACAC XXXXXXXXXX TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG msqRY CAAGCAGAAGACGGCATACGAGAT XXXXXXXXXX GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG PCR amplifications were performed in two rounds, the first to amplify the 18S region and add sample-specific multiplex-identifier (MID) tags and Illumina sequencing primers, the second to add the P5 and P7 sequencing adapters and additional MIDs. Each reaction mix for the first PCR contained 0.1 µM each of forward and reverse primer, 0.2 µg/µL BSA, 0.2 U Phusion DNA polymerase in 1 x Phusion Master Mix (New England Biolabs, Ipswich, MA, USA) and 1 micro L DNA extract in a total reaction volume of 10 micro L. PCR thermal cycling conditions were initial denaturation at 98 degrees C for 30 secs, followed by 25 cycles of 98 degrees C for 5 secs, 67 degrees C for 20 secs and 72 degrees C for 20 secs, with a final extension at 72 degrees C for 5 min. Replicate PCR products were pooled then diluted 1:10 and Illumina sequencing adapters added in a second round of PCR using the same reaction mix and thermal cycling conditions as the first round, except the concentration of BSA was halved (0.1 micro g/micro L), and the number of cycles was reduced to 10 with an annealing temperature of 55 degrees C. Products from each round of PCR were visualized on 2% agarose gels. Second round PCR products were pooled in equimolar ratios based on band intensity. The pooled products were purified using Agencourt AMPure XP beads (Beckman Coulter, Brea, CA, USA) and the concentration of the library measured using the Qubit dsDNA HS assay on a QUBIT 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA). The pool was diluted to 2 nM and paired-end reads generated on a MiSeq (Illumina, San Diego, CA, USA) with MiSeq Reagent Nano kit vs (300-cycles). Bacterial 16S rDNA PCR amplification and high-throughput sequencing Bioinformatics Reads were sorted by sample-specific MIDs added in the second round PCR using the MiSeq Reporter software. Fastq reads were merged using the -fastq_mergepairs command in USEARCH v8.0.1623 (Edgar 2010). Merged reads were sorted by "internal" 6 bp MID tags, and locus-specific primers trimmed with custom R scripts using the ShortRead package (Morgan et al. 2009), with only reads containing perfect matches to the expected MIDs and primers retained. Reads for all samples were dereplicated and global singletons discarded (-derep_fulllength -minuniquesize 2), and clustered into OTUs with the UPARSE algorithm (Edgar 2013) using the '-cluster_otus' command. Potentially chimeric reads were also discarded during this step. Reads for each sample were then assigned to OTUs (-usearch_global -id .97), and an OTU table generated using a custom R script. Taxonomy was assigned to each OTU using MEGAN version 5.10.5 (Huson et al. 2011) based on 50 hits per OTU generated by BLASTN searches against the NCBI 'nt' database (downloaded August 2015). Default LCA parameters were used, except Min support = 1, Min score = 100, Top percent = 10. Alpha and beta-diversity analyses were performed based on a rarefied OTU table with QIIME v1.8.0 (alpha_rarefaction.py, beta_diversity_through_plots.py, Caporaso et al. 2010). References Caporaso JG, Kuczynski J, Stombaugh J, et al. (2010) QIIME allows analysis of high-throughput community sequencing data. Nature Methods 7, 335-336. Huson DH, Mitra S, Ruscheweyh HJ, Weber N, Schuster SC (2011) Integrative analysis of environmental sequences using MEGAN4. Genome Research 21, 1552-1560. Jarman SN, McInnes JC, Faux C, et al. (2013) Adelie penguin population diet monitoring by analysis of food DNA in scats. PLoS One 8, e82227.
-
These data come from a set of experiments conducted on the coastal waters near Davis Station in January 2017. The first set of data are from a transect near the Sorsdal glacier and out to sea, to characterise DMSP-mediated phytoplankton bacteria interactions along a salinity gradient. The second data set are from a series of incubation experiments to gain deeper insight into the role of various infochemicals in Antarctic phytoplankton-bacteria relationships. Specifically, DMSP, VitB12, Tryptophan and Methionine. The last data set is derived from two incubation experiments: a short term DMSP addition experiment to look at its uptake and utilisation by the microbial community; and a longer-term (5 day) stable isotope probing experiment to track DMSP through the lower trophic food web.
-
RNA was extracted from pooled gonad tissues and tails of five sexually mature males and females, respectively, originating from the krill aquarium at the AAD in Tasmania, Australia. For RNA extractions, RNeasy mini kits (QIAGEN) were used and total RNA (8 micrograms each) was sent to Geneworks, South Australia (www.geneworks.com.au), for Illumina TruSeq 75 bp paired-end sequencing in two technical replica. Reads Yield Total Yield Krill_Male_sex_a_read1_sequence.txt 8,120,993 609,074,475 bases 1,218,148,950 bases Krill_Male_sex_a_read2_sequence.txt 8,120,993 609,074,475 bases Krill_Male_sex_b_read1_sequence.txt 10,465,586 784,918,950 bases 1,569,837,900 bases Krill_Male_sex_b_read2_sequence.txt 10,465,586 784,918,950 bases Krill_Male_tissue_a_read1_sequence.txt 7,867,804 590,085,300 bases 1,180,170,600 bases Krill_Male_tissue_a_read2_sequence.txt 7,867,804 590,085,300 bases Krill_Male_tissue_b_read1_sequence.txt 10,956,251 821,718,825 bases 1,793,118,450 bases Krill_Male_tissue_b_read2_sequence.txt 10,956,251 821,718,825 bases Krill_Female_sex_read1a_sequence.txt 29,447,654 2,208,574,050 bases 4,417,148,100 bases Krill_Female_sex_read2a_sequence.txt 29,447,654 2,208,574,050 bases Krill_Female_sex_read1b_sequence.txt 18,223,515 1,366,763,625 bases 2,733,527,250 bases Krill_Female_sex_read2b_sequence.txt 18,223,515 1,366,763,625 bases The insert size for these libraries is approx 160bp.
-
This metadata record contains an Excel spreadsheet with Operational Taxonomic Units (OTUs) gained from 16S rRNA gene sequencing of prokaryotes sampled from Biofilm slides deployed as part of the antFOCE experiment in the austral summer of 2014/15 at Casey station, East Antarctica. Refer to antFOCE report section 4.5.3 for deployment, sampling and analysis details. https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 Sampling design 2 trays of 8 horizontal standard glass microscope slides (72 x 25 mm) per chamber. Four of the glass slides were scored with a diamond pencil approximately 18 mm from the right hand end of the slide and deployed scored side up. The remaining four slides were unmodified. Slides were sampled at: * Tmid - one tray per chamber / open plot. The sampled try was repopulated with fresh slides and redeployed * Tend – 2 slides trays per chamber / open plot. Sampling procedure After 31 days deployment, 1 slide tray per chamber / open plot was sampled. At Tend both trays in each chamber / open plot were sampled. To minimize disturbance while being raised to the surface, each tray was removed from the tray holder by divers and placed in a seawater filled container with a lid. On the surface, slides were removed from the tray using ethanol sterilized forceps. The four unscoured slides per chamber / open plot were placed in a plastic microscope slide holder with a sealable lid. The scoured slides were placed individually in 70 ml plastic sample jars. Lab procedure - Casey The slide holder (4 unscoured slides) from each chamber / open plot was frozen at -20C immediately upon return to the lab. The scoured slides were preserved in sea water containing 1% final concentration glutaraldehyde in separate jars. Preservation Issue: Scoured slides were not refrigerated, either at Casey, during RTA or in Kingston before the 26th Nov 2015, when they were transferred to the 4C Cold Store. antFOCE Background The antFOCE experimental system was deployed in O'Brien Bay, approximately 5 kilometres south of Casey station, East Antarctica, in the austral summer of 2014/15. Surface and sub-surface (in water below the sea ice) infrastructure allowed controlled manipulation of seawater pH levels (reduced by 0.4 pH units below ambient) in 2 chambers placed on the sea floor over natural benthic communities. Two control chambers (no pH manipulation) and two open plots (no chambers, no pH manipulation) were also sampled to compare to the pH manipulated (acidified) treatment chambers. Details of the antFOCE experiment can be found in the report – "antFOCE 2014/15 – Experimental System, Deployment, Sampling and Analysis". This report and a diagram indicating how the various antFOCE data sets relate to each other are available at: https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 High throughput sequencing of the 16S rRNA gene (Shane Powell) Genomic DNA samples were sequenced at the Ramaciotti Centre for Genomics at the University of New South Wales. The V4 region of the 16S rRNA gene was sequenced with the primers 515F – 806R on an Illumina MiSeq with MiSeq v2 reagent kit. Sequences were processed using MOTHUR v 1.36.1 (Schloss et al. 2009) following the suggested protocol for processing MiSeq datasets as described in Kozich et al. (2013) with the following modifications. The make.contigs command was used to join the paired-end reads from the fastaq files. Sequences that were longer than 300 bp or contained more than one ambiguous base were removed with the screen.seqs. Within each sample, exact duplicate sequences were merged with unique.seqs. The sequences were then aligned against the Silva database (downloaded March 1 2016). Sequences with 3 or less nucleotide differences in total were clustered together using pre.cluster. Potentially chimeric sequences were removed with the defaults settings of the MOTHUR implementation of uchime. After removal of chimeric sequences, the remaining sequences were grouped into operational taxonomic units (OTU) using cluster.split with taxlevel=4 (Order). Finally a table of the number of times each OTU appeared in each sample was generated with make.shared with a cut-off of 0.03 and the OTU were classified with classify.otu. As the sample with the fewest sequences contained 63955 sequences, rarefaction was carried out using the sub.sample command to randomly select 63 955 sequences per sample. A total of 4 604 760 sequences remained in the final OTU table. Any OTU that contained less than 500 sequences (less than 0.01%) were removed as potentially spurious or chimeric sequences, especially as these were generally unclassified sequences. Multivariate analyses were carried out using the PRIMER software. Data were standardised (converted to a percentage) prior to any other analysis.... Kozich, J.J., Westcott, S.L., Baxter, N.T., Highlander, S.K. and Schloss, P.D., 2013. Development of a dual-index sequencing strategy and curation pipeline for analyzing amplicon sequence data on the MiSeq Illumina sequencing platform. Applied and environmental microbiology 79:5112-5120. Schloss, P.D., Westcott, S.L., Ryabin, T., Hall, J.R., Hartmann, M., Hollister, E.B., Lesniewski, R.A., Oakley, B.B., Parks, D.H., Robinson, C.J. and Sahl, J.W., 2009. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Applied and environmental microbiology 75:7537-7541.
-
Overview The aim of the project was to assess the genetic connectivity of benthic amphipods (crustaceans) on a circumantarctic scale. Two sibling amphipod species were chosen as the subjects for this study: Eusirus perdentatus and Eusirus giganteus. Samples of both species were collected (or donated by other institutions) from five broad regions of the Antarctic coast (see 'Sample location information' worksheet). The dataset we generated represents DNA sequences we obtained from these amphipods. Each amphipod was sequenced for three gene regions - these were cytochrome oxidase subunit I (COI), internal transcribed spacer 2 (ITS2) and cytochrome b (CytB). Each DNA sequence generated has been deposited on the publicly-accessible GenBank website (www.ncbi.nlm.nih.gov/genbank/) and therefore has its own accession number (which can be typed into the GenBank search bar to access the actual DNA sequence in .fasta format). The attached spreadsheet provides details on the location, depth and date of each amphipod sample collected, the preliminary species ID for each amphipod*, and the resultant DNA sequences corresponding to each of the three gene regions amplified (these are provided as Genbank accession numbers). *Results of this project have actually highlighted that Eusirus perdentatus and Eusirus giganteus almost certainly contain several extra cryptic species, therefore these ID's are likely to be revised in the future. Data collection and analysis The full methodology used to generate and analyse the DNA sequences prior to their deposition on Genbank can be found in the associated publication (see below). Most amphipod samples were collected between January 2007 and January 2010. However, a small proportion of the samples were collected on Polarstern voyages that took place in February 2002 and December 2003-January 2004. Genetic data was generated and analysed between June 2008 and May 2010. Circumantarctic DNA sequences obtained from two amphipod species, Eusirus perdentatus and Eusirus giganteus - DNA sequences obtained from two sibling amphipod species, Eusirus perdentatus and Eusirus giganteus. Samples of both species were collected (or donated by other institutions) from five broad regions of the Antarctic coast: Tressler Bank, East Coast, Ross Sea, Antarctic Peninsula and Weddell Sea. Collection dates ranged from 2002 to 2010. Sample location information is included. Explanation of spreadsheet Worksheet: 'Samples and genetic data' This worksheet contains all of the actual data generated, although rather than providing entire genetic sequences, we provide the Genbank accession number which can be used to access the sequence online (as explained above). The column headings are as follows: Sample ID- a unique code given to each amphipod sample as a form of identity. Morphological ID- the species identification for each amphipod, as determined morphologically (i.e. the genetic data has since illuminated that these IDs may need revision in the future). Sampling site- a code for the exact location from which each amphipod was sampled. For details on these locations, refer to 'Sample location information' worksheet, which uses the same codes. DNA sequence (Genbank accession number)- Genbank accession numbers for the DNA sequences obtained from each amphipod. The three columns within this represent the three gene regions we sequenced: COI (cytochrome oxidase subunit I), CytB (cytochrome b) and ITS2 (internal transcribed spacer 2). Occasionally one of these gene regions would fail to amplify in a particular sample, or the sequence was ambiguous, therefore not all amphipod samples have an accession number for all three gene regions. Worksheet: 'Sample location information' This worksheet provides the details on the actual collection of the amphipod specimens. Column headings are as follows: Sampling site- the code for each site from which amphipods were sampled, as used in the previous worksheet. Latitude- coordinates for each sampling site. Longitude- coordinates for each sampling site. Depth range of trawl (m)- As all amphipod samples were collected in benthic trawls deployed from research vessels, this column provides the depth range of the seabed over which each trawl was dragged. Collection date- the month and year in which each site was sampled. Region of Antarctic coast- the broad geographic region of the Antarctic coastline into which each set of sampling sites is grouped. Research vessel- the research vessel from which benthic trawls were deployed to collect the amphipods at each site. Note that for each broad geographic region, a single vessel was responsible for collecting all samples.
-
1st Experiment 24/11/16 ************************************************************************************************ See 2016_11_24_Miseq_Sheet 1. Sanger Sequencing Plate #4 - 25mg of Tissue was extracted by AGRF. DNA was diluted to 5ng/ul. Samples were sanger sequenced with 16SAR (Palumbi) primer. If they failed, I used COI3 cocktail (Ivanova). FASTA sequences from Plate 4 are in the folder named Sanger Sequence FASTA Plate #4. Naming - Plate position, primer, sample ID. ie reater than A1-16S-AR_1952. 2. DNA and Tissue Pools of Plate 4 We wanted to explore the possibility of using a metabarcoding approach. For metabarcoding we re-examined specimens already identified from sanger sequences. We mixed DNA from many samples (n=16 or n=96) and did a single amplification (i.e. up to 96 DNA extractions processed in a single-tube marker amplification). We also took it a step further and tried blending a set amount of tissue from many fish specimens (n=16 or n=96) and did a single DNA extraction on the tissue mixes (i.e. a single DNA extraction and single tube amplification for up to 96 samples). See 2016_11_24_Miseq_Sheet for DNA and Tissue Pool mixes. 3. Miseq Run 16 samples were ran on a 250bp pe read. Each sample was amplified with 3 primer sets - COI (please note one dual labelled set was used), 12s and 16s (Primers listed on 2016_11_24_Miseq_Sheet). They were diluted 1:10 and illumina sequencing adaptors were added (please note I used same I7 and I5 per sample, so they had to be sorted on amplicon). 2016_11_24_fastq_files has the data from miseq. and 2016_11_24_merged_fastq_files has the merged files. For some unknown reason 16s tissue produced no data. 2nd Experiment 04/07/17 ************************************************************************************************* 1. DNA Extractions Plate #1, 2 and 3 - 25mg of Tisse was extracted by AGRF. DNA was diluted to 5ng/ul. We also used Plate #4 from experiment above. See Plate Layout for sample allocation. 2. Tissue and DNA Pools DNA pools were from Plate 1, 2, 3 and 4. Tissue Mixes were from Plate 2 and 4 only. We wanted to explore the possibility of using a metabarcoding approach. We mixed DNA from many samples (n=16 or n=96) and did a single amplification (i.e. up to 96 DNA extractions processed in a single-tube marker amplification). We also took it a step further and tried blending a set amount of tissue from many fish specimens (n=16 or n=96) and did a single DNA extraction on the tissue mixes (i.e. a single DNA extraction and single tube amplification for up to 96 samples). See plate layout for DNA and Tissue Pool mixes. 3. Miseq Run 577 samples were sequenced in a 250bp pe read. See 2017_07_04_Miseq Sheet. Plate 1, 2 3 and 4 were all sequenced with Leray Primers.(Please note I accidentally amplified the first half of plate one with one pair of dual labelled COI primers, index on miseq sheet). I also made a plate of tissue and DNA pools (see plate layout for DNA and Tissue Pool mixes) and amplified those with 4 primers (primer sequences on miseq sheet) COI (individual dual labelled primers, 1st round index are on miseq sheet) 12s Fish 16s Chordate NADH The last 4 samples with 12s were to add to database as there are no 12S sequences for those species on genbank. See PCR recipes for annealing temp and cycling etc I accidentally put the marker under sample name so the original sample ID was lost and miseq gave it a new name (name from miseq output) and then another new name from merged file. Finally I gave them a unique sample ID. See name file if you need more information. 2017_07_04 has the data from miseq. and 2017_07_04_merged_fastq_files has the merged files. Samples were clustered using zero radius OTU's. 4.Results See Results database. The spreadsheet has all of the possible name combinations from the run. It also contains the Haul ID and date, time, lat, long etc. There is a morph taxa ID which refers to what the observer has identified the fish and then there is Seq_Taxa_ID which is the sequencing result. There is also a list of primers that were used to identify the fish. 0 indicated that the primer wasnt used, 1 indicates it was. The second tab has all of the info for the samples that failed. *************************************************************************************************
-
June 2018 Adélie penguin scats were collected from Signy Island (South Orkney Islands) during crèche (December/January) 2014/15 and 2015/16 and stored in 80% Ethanol. DNA was extracted from ~30 mg of faecal material using a Promega ‘Maxwell 16' instrument and a Maxwell® 16 Tissue DNA kit. A total of 450 samples were analysed: 30 extractions per week for 2015 and 60 per week for samples collected in 2016. Three DNA markers providing different taxonomic information were amplified from penguin faecal DNA. First, ALL faecal DNA samples were characterised using a highly conserved metazoan primer set that amplifies a region of the nuclear 18S gene. In addition, a subset of faecal samples from each year were also characterised with two other primer pairs that amplify a region of the mtDNA 16S gene to allow species-level identification for most fish (16S_Fish) and krill (16S_Krill) species respectively. During amplification of markers, the products were tagged with a unique pair of index primers allowing samples to be pooled and sequenced (2x150bp) on a MiSeq high-throughput DNA sequencer. - See Adelie Pengiun Diet CCAMLR paper for all of the primer/PCR details - See BAS Adelie 18s Krill and Fish subset excel spreadsheet for sample details. - See BAS Adelie 18s ALL samples fastq for 18s fastq files - See BAS Adelie 16s Krill subset fastq for 16s krill fastq files - See BAS Adelie Fish subset fastq for 16s fish fastq files ##################################################################################### November 2018 In addition we also amplified all 450 samples with the 16S_Fish marker. - See Adelie Experiment Details 16s Fish for sample details, plate layout, first and second round PCR and miseq sheet. - See BAS Adelie Fish ALL Samples fastq for 16s fish fastq files
-
This restriction site associated DNA sequencing (RAD-seq) dataset for Antarctic krill (Euphausia superba) includes raw sequence data and summaries for 148 krill from 5 Southern Ocean sites. A detailed README.pdf file is provided to describe components of the dataset. DNA library preparation was carried out in two separate batches by Floragenex (Eugene, Oregon, USA). RAD fragment libraries (SbfI) were sequenced on an Illumina HiSeq 2000 using single-end 100 bp chemistry. As there is no reference genome for Antarctic krill, a set of unique 90 bp sequences (RAD tags) was assembled from 17.3 million single-end reads from an individual krill. We obtained over a billion raw reads from the 148 krill in our study (a mean of 6.8 million reads per sample). The reference assembly contained 239,441 distinct RAD tags. The core genotype dataset exported for downstream data filtering included just those SNPs with genotype calls in at least 80% of the krill samples and contained 12,114 SNPs on 816 RAD tags. Sample collection table (comma separated): Southern Ocean Location, Sample Size, Austral Summer, Latitude, Longitude, ID East Antarctica (Casey), 21, 2010/2011, 64S, 100E, Cas East Antarctica (Mawson), 22, 2011/2012. 66S, 70E, Maw Lazarev Sea, 38, 2004/2005 and 2007/2008, 66S, 0E, Laz Western Antarctic Peninsula, 16, 2010/2011, 69S, 76W, WAP Ross Sea, 23, 2012/2013, 68S, 178E, Ross