General description: The associated file contains sediment pigment data from the antFOCE project 4127. Units: all pigment data in ug/g, 0 = below detection limit of HPLC. Sample collection details: At the start and end of the antFOCE experiment, four sediment core samples were taken from inside and outside each chamber or open plot by divers. The top 1 cm of the cores was then removed and placed in the dark, first at -20ºC for 2 hours, then at -80ºC until analysis at the Australian Antarctic division. Pigment analysis Frozen samples were transported under liquid N2 to a freeze drier (Dynavac, model FD-5), in pre-chilled flasks with a small amount of liquid N2 added. Custom made plumbing fitted to the freeze drier enabled samples to be purged with N2 to prevent photo-oxidation up until solvent extraction. Prior to pigment extraction five 2 g stainless steel ball bearings were added to homogenise the freeze dried sediment. The samples were bead beaten for 1 minute (Biospec products). Subsamples (~0.05 g) were immediately transferred to cryotubes with 700 µl of dimethylformamide (DMF) for two hours. Samples were kept at -80ºC and under a safe light (IFORD 902) at all times. All pigment concentrations are standardised to sediment weight. Pigments were extracted with dimethylformamide (DMF 700 µl) over a two hour period at -20ºC. Zirconia beads, and 100 µl of Apo 8 and an internal standard were added to each sub-sample. After a two hour extraction, sub-samples were bead beaten for 20 seconds and then placed in a centrifuge with filter cartridge inserts for 14 minutes at 2500 rpm at -9ºC to separate the solvent from the sediment. The supernatant was transferred into to a vial and placed in a precooled rpHPLC autosampler. The rpHPLC system used is described in Hodgson et al. (1997). Pigment detection was at 435, 470 and 665 nm for all chlorophylls and carotenoids, with spectra from 300–700 nm being collected every 0.2 seconds. Pigment identification was carried out using a combination of rpHPLC and normal phase HPLC retention times, light absorbance spectra and reference standards (see Hodgson et al., 1997). These techniques assisted in the accurate identification of pigments and their derivatives to a molecular level and enabled several pigment derivatives to be analysed. The HPLC was previously calibrated with authentic standards and protocols outlined in SCOR (1988). Data set headers: (A)Treatment: Example code 4127_SOP7_6-1-15_PlotB_R1, = prodject code_Standard Operating Procedure(SOP) used to collect samples(see antFOCE parent file)_ Date_Chamber/plot(A,B,C,D)_replicate core within Chamber/plot(1,2,3) (B) BB carot= BB caroten, type of pigment detected by HPLC. See Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more details. (C) Chl c1 = Chlorophyll derivatives see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (D) Chl c2 = Chlorophyll derivatives see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (E) Chl c3 = Chlorophyll derivative see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (F) Chla = Chlorophyll a see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (G) Ddx =Diadinoxanthin see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information (H) dtx = Diatoxanthin pigment. see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information (I) epi = Chlorophyll epimer pigment. see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (j) Fuc = Fucoxanthin pigment. see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (k) Gyro2 = Gyroxanthin pigment. see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (L) Pras = Prasanthin pigment. see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (m) Zea = Zeaxanthin pigment. see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (n) Date = Samples taken at the start of antFOCE experiment or at the end (o) chamber = The antFOCE chamber (A,B,C,D) (p) Treatment = The associated pH level in chambers (Acidified ~7.8, Control ~8.2) (Q) Position = Samples were taken within chambers and outside chambers (outside, inside) (r) rep= Subsamples were taken within each chamber/position (R1=replicate one, R1-R4) Spatial coordinates: 66.311500 S, 110.514216 E Dates: between 1/12/2014 and 1/3/2015 Timezone:UTC+11

Refer to antFOCE report section 4.4.1 for deployment, sampling and analysis details. https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 The download file contains an Excel workbook with 2 data spreadsheets - one for the greater than 1mm fraction and one for the 0.5mm to 1mm fraction of the macrofauna - and a third of notes relevant to the data. The data are the total number of each organism collected from sediment cores taken in and adjacent to chambers or open plots during the antFOCE experiment. Analysis methods are detailed in the Notes spreadsheet. Background The antFOCE experimental system was deployed in O’Brien Bay, approximately 5 kilometres south of Casey station, East Antarctica, in the austral summer of 2014/15. Surface and sub-surface (in water below the sea ice) infrastructure allowed controlled manipulation of seawater pH levels (reduced by 0.4 pH units below ambient) in 2 chambers placed on the sea floor over natural benthic communities. Two control chambers (no pH manipulation) and two open plots (no chambers, no pH manipulation) were also sampled to compare to the pH manipulated (acidified) treatment chambers. Details of the antFOCE experiment can be found in the report – “antFOCE 2014/15 – Experimental System, Deployment, Sampling and Analysis”. This report and a diagram indicating how the various antFOCE data sets relate to each other are available at: https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127

This data set was collected from a ocean acidification minicosm experiment performed at Davis Station, Antarctica during the 2014/15 summer season. It includes: - description of methods for all data collection and analyses. - flow cytometry counts; autotrophic cells, heterotrophic nanoflagellates, and prokaryotes

Synchrotron based FTIR macromolecule profiles of 5 diatom species from the AAS_4026 ocean acidification project. Data represent the peak areas for wavenumbers related to key macromolecules. For details on methods see Duncan et al. (2021) New Phytologist. Experimental design and mesocosm set up Mesocosm set up and conditions were as described previously (Deppeler et al., 2018; Hancock et al., 2018). Briefly, a near-shore, natural Antarctic microbial community was collected from an ice-free area among broken fast ice approximately 1km offshore from Davis Station, Antarctica (68° 35ʹ S, 77° 58ʹ E) on 19 November 2014. This community was incubated in 6 x 650L polyurethane tanks (mesocosms) across a gradient of fCO2 levels (343, 506, 634, 953, 1140 and 1641 μatm; denoted M1 – M6). These fCO2 levels corresponded to pH values ranging from 8.17 to 7.57. Temperature was maintained at 0.0 °C ± 0.5 °C and the mesocosms were stirred continuously by a central auger (15 r.p.m.) for gentle mixing and covered with an air-tight lid. Irradiance was initially kept low (0.8 ± 0.2 μmol photons m-2s-1), while cell physiology was left to acclimate to increasing fCO2 levels (over 5 days). When target fCO2 levels were reached in all six mesocosms, light was gradually increased (days 5-8) to 89 ± 16 μmol photons m-2s-1 on a 19 h:5 h light:dark cycle, to mimic current natural conditions. To generate the gradient in carbonate chemistry, filtered seawater saturated with CO2 was added to five of the mesocosms. Daily measurements were taken to monitor pH and dissolved inorganic carbon (DIC). For details of fCO2 manipulations, analytical procedures and calculations see Deppeler et al., (2018). Samples for physiological and macromolecular measurements in this study were taken on day 18, at the end of the incubation period (Deppeler et al., 2018). Cell volume Cell volume was determined for selected taxa from M1 and M6 via light microscopy. Cells were imaged on a calibrated microscope (Nikon Eclipse Ci-L, Japan) and length, width and height (24-77 cells per taxa) determined using ImageJ software (Schneider et al., 2012). Biovolume was then calculated according to the cell morphology and corresponding equations described by Hillebrand et al (1999). Macromolecular content by FTIR The macromolecular composition of the selected diatom taxa sampled from all six mesocosms on day 18 was determined using Synchrotron based FTIR microspectroscopy on formalin-fixed (2% v/v final concentration) cells. Measurements were made on hydrated cells and processed according to previous studies (Sackett et al. 2103; 2014; Sheehan et al. 2020). Briefly, fixed cells were loaded directly onto a micro-compression cell with a 0.3 mm thick CaF2 window. Spectral data of individual cells (between 15-49 cells per taxon per mesocosm) were collected in transmission mode, using the Infrared Microspectroscopy Beamline at the Australian Synchrotron, Melbourne, in November 2015. Spectra were acquired over the measurement range 4000− 800 cm−1 with a Vertex 80v FTIR spectrometer (Bruker Optics) in conjunction with an IR microscope (Hyperion 2000, Bruker) fitted with a mercury cadmium telluride detector cooled with liquid nitrogen. Co-added interferograms (n = 64) were collected at a wavenumber resolution of 6 cm−1s. To allow for measurements of individual cells, all measurements were made in transmission mode, using a measuring area aperture size of 5 × 5 µm. Spectral acquisition and instrument control were achieved using Opus 6.5 software (Bruker). Normalised spectra of biologically relevant regions revealed absorbance bands representative of key macromolecules were selected. Specifically, the amide II (~1540 cm-1), Free Amino Acid (~1452 cm-1), Carboxylates (~1375 cm-1), Ester carbonyl from lipids (~1745 cm-1) and Saturated Fatty Acids (~2920 cm-1) bands were selected. Infra-red spectral data were analysed using custom made scripts in R (R Development Core Team 2018). The regions of 3050-2800, 1770-1100 cm-1, which contain the major biological were selected for analysis. Spectral data were smoothed (4 pts either side) and second derivative (3rd order polynomial) transformed using the Savitzky-Golay algorithm from the prospectr package in R (Stevens and Ramirez-Lopez, 2014) and then normalised using the method of Single Normal Variate (SNV). Macromolecular content for individual taxon was estimated based on integrating the area under each assigned peak, providing metabolite content according to the Beer-Lambert Law, which assumes a direct relationship between absorbance and relative analyte concentration (Wagner et al., 2010). Integrated peak areas provide relative changes in macromolecular content between samples. Because of the differences in absorption properties of macromolecules, peak areas can only be used as relative measure within compounds.

This dataset contains pulse amplitude modulated (PAM) fluorometry measurements and chlorophyll concentrations for a series of incubation experiments performed during the 2012 SIPEX marine science voyage. The PAM files are in a raw format, but can be opened using Microsoft Excel. Light curves have not been processed. Bloom potential: 4-8 ice cores were collected from 4 fast ice stations during SIPEXII (Stations 20120926, 20121006, 20121013, 20121019) and ice collected from the back of the ship (Underway ice collection). The bottom 3cm was shaved off each ice core into filtered seawater. The concentration of chlorophyll a in the slurry was measured using a Turner 10AU fluorometer and the physiological health was determined using a PAM fluorometer. 5 x 50ml cultures from each ice station were incubated for 15-30 days (~50uE, ~0.2 degrees). At the end of the incubation period, the physiological health of the cultures was measured again, as was chlorophyll a. Post-incubation samples were also collected to determine nutrient concentration and species composition. C02: Brine algae was collected from sack holes drilled to a depth of ~45cm from 3 fast ice stations during SIPEXII (Stations 20121006, 20121013, 20121019). PAM fluorometry was used to measure cell health prior to the brine solution being aliquoted into 50ml culture vials to produce 4 treatments: 0.1% CO2, 1% CO2, 2% CO2, control. Cultures were incubated for 7-12 days. Post incubation analyses included: PAM, chlorophyll a, DIC, TA and cell identification. Samples were also collected for DNA extraction, which was performed at sea. The files in this dataset are: 1. McMinn Bloom Dynamics folder. This folder contains raw PAM data from each of the experiments. This is highly specialised photophysiology data, please consult the Walz PAM manual (www.walz.com) for interpretation. The dates and duration of each incubation experiment can be determined from the raw data. 2. McMinn CO2 folder. This contains raw PAM data, dates and experiment duration.

This metadata record contains an Excel spreadsheet with Operational Taxonomic Units (OTUs) gained from Eukaryotic 18S rDNA PCR amplification and high-throughput sequencing of samples from Biofilm slides deployed as part of the antFOCE experiment in the austral summer of 2014/15 at Casey station, East Antarctica. Refer to antFOCE report section 4.5.3 for deployment, sampling and analysis details. https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 Sampling design 2 trays of 8 horizontal standard glass microscope slides (72 x 25 mm) per chamber. Four of the glass slides were scored with a diamond pencil approximately 18 mm from the right hand end of the slide and deployed scored side up. The remaining four slides were unmodified. Slides were sampled at: - Tmid - one tray per chamber / open plot. The sampled try was repopulated with fresh slides and redeployed - Tend – 2 slides trays per chamber / open plot. Sampling procedure After 31 days deployment, 1 slide tray per chamber / open plot was sampled. At Tend both trays in each chamber / open plot were sampled. To minimize disturbance while being raised to the surface, each tray was removed from the tray holder by divers and placed in a seawater filled container with a lid. On the surface, slides were removed from the tray using ethanol sterilized forceps. The four unscoured slides per chamber / open plot were placed in a plastic microscope slide holder with a sealable lid. The scoured slides were placed individually in 70 ml plastic sample jars. Lab procedure - Casey The slide holder (4 unscoured slides) from each chamber / open plot was frozen at -20C immediately upon return to the lab. The scoured slides were preserved in sea water containing 1% final concentration glutaraldehyde in separate jars. Preservation Issue: Scoured slides were not refrigerated, either at Casey, during RTA or in Kingston before the 26th Nov 2015, when they were transferred to the 4C Cold Store. antFOCE Background The antFOCE experimental system was deployed in O’Brien Bay, approximately 5 kilometres south of Casey station, East Antarctica, in the austral summer of 2014/15. Surface and sub-surface (in water below the sea ice) infrastructure allowed controlled manipulation of seawater pH levels (reduced by 0.4 pH units below ambient) in 2 chambers placed on the sea floor over natural benthic communities. Two control chambers (no pH manipulation) and two open plots (no chambers, no pH manipulation) were also sampled to compare to the pH manipulated (acidified) treatment chambers. Details of the antFOCE experiment can be found in the report – "antFOCE 2014/15 – Experimental System, Deployment, Sampling and Analysis". This report and a diagram indicating how the various antFOCE data sets relate to each other are available at: https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 AntFOCE biofilm DNA methods Laurence Clarke, Shane Powell, Bruce Deagle DNA extraction The biofilm was removed from the top of each slide with a cotton swab and DNA extracted directly from the swab using the MoBio PowerBiofilm DNA isolation kit following the manufacturer’s protocol. Extraction blanks were extracted in parallel to detect contamination. Eukaryotic 18S rDNA PCR amplification and high-throughput sequencing DNA extracts were PCR-amplified in triplicate with primers designed to amplify 140-170 bp of eukaryotic 18S ribosomal DNA (Jarman et al. 2013). The forward primer was modified to improve amplification of protists. Table 1. First and second round primers, including MID tags (Xs). ILF_ProSSU3'F_X TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG XXXXXX CACCGCCCGTCGCWMCTACCG ILR_SSU3'R_Y GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG XXXXXX GGTTCACCTACGGAAACCTTGTTACG msqFX AATGATACGGCGACCACCGAGATCTACAC XXXXXXXXXX TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG msqRY CAAGCAGAAGACGGCATACGAGAT XXXXXXXXXX GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG PCR amplifications were performed in two rounds, the first to amplify the 18S region and add sample-specific multiplex-identifier (MID) tags and Illumina sequencing primers, the second to add the P5 and P7 sequencing adapters and additional MIDs. Each reaction mix for the first PCR contained 0.1 µM each of forward and reverse primer, 0.2 µg/µL BSA, 0.2 U Phusion DNA polymerase in 1 x Phusion Master Mix (New England Biolabs, Ipswich, MA, USA) and 1 micro L DNA extract in a total reaction volume of 10 micro L. PCR thermal cycling conditions were initial denaturation at 98 degrees C for 30 secs, followed by 25 cycles of 98 degrees C for 5 secs, 67 degrees C for 20 secs and 72 degrees C for 20 secs, with a final extension at 72 degrees C for 5 min. Replicate PCR products were pooled then diluted 1:10 and Illumina sequencing adapters added in a second round of PCR using the same reaction mix and thermal cycling conditions as the first round, except the concentration of BSA was halved (0.1 micro g/micro L), and the number of cycles was reduced to 10 with an annealing temperature of 55 degrees C. Products from each round of PCR were visualized on 2% agarose gels. Second round PCR products were pooled in equimolar ratios based on band intensity. The pooled products were purified using Agencourt AMPure XP beads (Beckman Coulter, Brea, CA, USA) and the concentration of the library measured using the Qubit dsDNA HS assay on a QUBIT 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA). The pool was diluted to 2 nM and paired-end reads generated on a MiSeq (Illumina, San Diego, CA, USA) with MiSeq Reagent Nano kit vs (300-cycles). Bacterial 16S rDNA PCR amplification and high-throughput sequencing Bioinformatics Reads were sorted by sample-specific MIDs added in the second round PCR using the MiSeq Reporter software. Fastq reads were merged using the -fastq_mergepairs command in USEARCH v8.0.1623 (Edgar 2010). Merged reads were sorted by "internal" 6 bp MID tags, and locus-specific primers trimmed with custom R scripts using the ShortRead package (Morgan et al. 2009), with only reads containing perfect matches to the expected MIDs and primers retained. Reads for all samples were dereplicated and global singletons discarded (-derep_fulllength -minuniquesize 2), and clustered into OTUs with the UPARSE algorithm (Edgar 2013) using the '-cluster_otus' command. Potentially chimeric reads were also discarded during this step. Reads for each sample were then assigned to OTUs (-usearch_global -id .97), and an OTU table generated using a custom R script. Taxonomy was assigned to each OTU using MEGAN version 5.10.5 (Huson et al. 2011) based on 50 hits per OTU generated by BLASTN searches against the NCBI 'nt' database (downloaded August 2015). Default LCA parameters were used, except Min support = 1, Min score = 100, Top percent = 10. Alpha and beta-diversity analyses were performed based on a rarefied OTU table with QIIME v1.8.0 (alpha_rarefaction.py, beta_diversity_through_plots.py, Caporaso et al. 2010). References Caporaso JG, Kuczynski J, Stombaugh J, et al. (2010) QIIME allows analysis of high-throughput community sequencing data. Nature Methods 7, 335-336. Huson DH, Mitra S, Ruscheweyh HJ, Weber N, Schuster SC (2011) Integrative analysis of environmental sequences using MEGAN4. Genome Research 21, 1552-1560. Jarman SN, McInnes JC, Faux C, et al. (2013) Adelie penguin population diet monitoring by analysis of food DNA in scats. PLoS One 8, e82227.

Refer to antFOCE report section 2.3 for deployment, sampling and analysis details. https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 The download file contains an Excel workbook with a series of data spreadsheets - one for each of the Onset Hoboware Tidbit v2 (UTBI-001) temperature loggers that were attached to the outside of various pieces of the underwater experimental infrastructure across the antFOCE site. A Notes spreadsheet is also included with information relevant to the data. Background The antFOCE experimental system was deployed in O'Brien Bay, approximately 5 kilometres south of Casey station, East Antarctica, in the austral summer of 2014/15. Surface and sub-surface (in water below the sea ice) infrastructure allowed controlled manipulation of seawater pH levels (reduced by 0.4 pH units below ambient) in 2 chambers placed on the sea floor over natural benthic communities. Two control chambers (no pH manipulation) and two open plots (no chambers, no pH manipulation) were also sampled to compare to the pH manipulated (acidified) treatment chambers. Details of the antFOCE experiment can be found in the report – "antFOCE 2014/15 – Experimental System, Deployment, Sampling and Analysis". This report and a diagram indicating how the various antFOCE data sets relate to each other are available at: https://data.aad.gov.au/metadata/AAS_4127_antFOCE_Project4127

Gas Flux over Sea Ice ------------- We observed amount of gas exchange between sea ice and atmosphere. At the ice station, semi-automated chambers developed in Japan, were used for measurement of air-sea ice CO2 flux. These chambers could be used to examine spatial variability and also temporal variability of gas flux over sea ice. Samples were also taken from the snow and ice in order to measure CH4 and VOC, however these analyses will be conducted post-voyage. This metadata record will be updated in future to reflect the analysis. The chambers are designed to be placed over a snow and sea ice. When the lid is closed, CO2 concentration was measured. The opening and closing functions of the chambers are automated and were set to a 30 minutes interval. CO2 concentration (as voltage) were recorded in the data logger (CR10X, Campbell Scientific Inc.) and downloaded after the experiments. Raw data are contained in the excel files. During the CO2 flux measurement, we collected the snow, sea ice, brine/slush and under-ice water. Snow and sea ice samples were melted after sampling in PVDF film bags (like Tedlar bags in order to avoid gas exchange with ambient air) in 4C temperature and treated for analysis. A chemical analysis for carbonate systems and VOC (water), salinity, nutrient, pigment and oxygen isotopic ratio samples will take place in Japan after the voyage for analysis. During the cruise, to examine ice growth processes, we made sea ice thin-section to classify the ice cores into granular ice, columnar ice or mixed granular and columnar ice (Eicken and Lange, 1989). The CO2 data are contained in Excel spreadsheets. These use Japanese column headings. Calcium Carbonate (CACO3.6H20) as Ikaite in Sea Ice and Snow ----------- At each listed ice station we collected sea-ice cores using a Kovacs 9cm ice corer. Cores were sectioned into 10-20cm and melted at 4 degrees C, filtered and dried for later analysis of Calcium Carbonate in a home laboratory using an ICP, which produces text file outputs (included). Also included is a spreadsheet listing the cores, and the calcium carbonate measurements.

Refer to antFOCE report section 4.5.2 for deployment, sampling and analysis details. https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 The download file contains an Excel workbook with one data spreadsheet and one of notes relevant to the data. The data are the total number of each organism collected from artificial substrate units (plastic pot scourers) deployed in chambers or open plots during the antFOCE experiment (Data = Number of Individuals). Analysis methods are detailed in the Notes spreadsheet. Background The antFOCE experimental system was deployed in O’Brien Bay, approximately 5 kilometres south of Casey station, East Antarctica, in the austral summer of 2014/15. Surface and sub-surface (in water below the sea ice) infrastructure allowed controlled manipulation of seawater pH levels (reduced by 0.4 pH units below ambient) in 2 chambers placed on the sea floor over natural benthic communities. Two control chambers (no pH manipulation) and two open plots (no chambers, no pH manipulation) were also sampled to compare to the pH manipulated (acidified) treatment chambers. Details of the antFOCE experiment can be found in the report – “antFOCE 2014/15 – Experimental System, Deployment, Sampling and Analysis”. This report and a diagram indicating how the various antFOCE data sets relate to each other are available at: https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127

Carbonate chemistry data sets for the Antarctic Free Ocean Carbon Dioxide Enrichment experiment, Casey Station, East Antarctica, 2014/15. Project Summary: Currently, a quarter of the CO2 we emit is absorbed by the ocean. CO2 absorption in seawater changes its chemistry – reducing ocean pH (raising its acidity) – which has significant impacts on biological processes and serious implications for the resilience of marine ecosystems. As CO2 is more soluble in cold water we expect polar ecosystems to bear the heaviest burden of this 'ocean acidification'. We will perform the first in situ polar CO2 enrichment experiment to determine the likely impacts of ocean acidification on Southern Ocean sea-floor communities under increasing CO2 emissions.