This video is supplementary data for the publication entitled 'Internal physiology of live krill revealed using new aquaria techniques and mixed optical microscopy and optical coherence tomography (OCT) imaging techniques'. The video is high resolution microscopy video of a live krill captured in the krill containment trap placed within the water bath. File size: 1.8 GB, 32 s duration. The optical microscopy was carried out using a Leica M205C dissecting stereomicroscope with a Leica DFC 450 camera and Leica LAS V4.0 software to collect high-resolution video. The experimental krill research project is designed to focus on obtaining life history information of use in managing the krill fishery - the largest Antarctic fishery. In particular, the project will concentrate on studies into impacts of climate change on key aspects of krill biology and ecology.

Metadata record for data from ASAC Project 2547 See the link below for public details on this project. Pue (greater than 90% as determined by SDS-PAGE) samples of nitrate reductase have been isolated from the Antarctic bacterium, Shewanella gelidimarina (ACAM 456T; Accession number U85907 (16S rDNA)). The protein is ~90 kDa (similar to nitrate reductase enzymes characterised from alternate bacteria) and stains positive in an in-situ nitrate reduction (native) assay technique. The protein may be N-terminal blocked, although further sequencing experiments are required to confirm this. This work is based upon phenotyped Antarctic bacteria (S. gelidimarina; S.frigidimarina) that was collected during other ASAC projects. (Refer: Psychrophilic Bacteria from Antarctic Sea-ice and Phospholipids of Antarctic sea ice algal communities new sources of PUFA [ASAC_708] and Biodiversity and ecophysiology of Antarctic sea-ice bacteria [ASAC_1012]). The download file contains 4 scientific papers produced from this work - one of these papers also contains a large set of accession numbers for data stored at GenBank.

This metadata record contains an Excel spreadsheet with Operational Taxonomic Units (OTUs) gained from Eukaryotic 18S rDNA PCR amplification and high-throughput sequencing of samples from Biofilm slides deployed as part of the antFOCE experiment in the austral summer of 2014/15 at Casey station, East Antarctica. Refer to antFOCE report section 4.5.3 for deployment, sampling and analysis details. https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 Sampling design 2 trays of 8 horizontal standard glass microscope slides (72 x 25 mm) per chamber. Four of the glass slides were scored with a diamond pencil approximately 18 mm from the right hand end of the slide and deployed scored side up. The remaining four slides were unmodified. Slides were sampled at: - Tmid - one tray per chamber / open plot. The sampled try was repopulated with fresh slides and redeployed - Tend – 2 slides trays per chamber / open plot. Sampling procedure After 31 days deployment, 1 slide tray per chamber / open plot was sampled. At Tend both trays in each chamber / open plot were sampled. To minimize disturbance while being raised to the surface, each tray was removed from the tray holder by divers and placed in a seawater filled container with a lid. On the surface, slides were removed from the tray using ethanol sterilized forceps. The four unscoured slides per chamber / open plot were placed in a plastic microscope slide holder with a sealable lid. The scoured slides were placed individually in 70 ml plastic sample jars. Lab procedure - Casey The slide holder (4 unscoured slides) from each chamber / open plot was frozen at -20C immediately upon return to the lab. The scoured slides were preserved in sea water containing 1% final concentration glutaraldehyde in separate jars. Preservation Issue: Scoured slides were not refrigerated, either at Casey, during RTA or in Kingston before the 26th Nov 2015, when they were transferred to the 4C Cold Store. antFOCE Background The antFOCE experimental system was deployed in O’Brien Bay, approximately 5 kilometres south of Casey station, East Antarctica, in the austral summer of 2014/15. Surface and sub-surface (in water below the sea ice) infrastructure allowed controlled manipulation of seawater pH levels (reduced by 0.4 pH units below ambient) in 2 chambers placed on the sea floor over natural benthic communities. Two control chambers (no pH manipulation) and two open plots (no chambers, no pH manipulation) were also sampled to compare to the pH manipulated (acidified) treatment chambers. Details of the antFOCE experiment can be found in the report – "antFOCE 2014/15 – Experimental System, Deployment, Sampling and Analysis". This report and a diagram indicating how the various antFOCE data sets relate to each other are available at: https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 AntFOCE biofilm DNA methods Laurence Clarke, Shane Powell, Bruce Deagle DNA extraction The biofilm was removed from the top of each slide with a cotton swab and DNA extracted directly from the swab using the MoBio PowerBiofilm DNA isolation kit following the manufacturer’s protocol. Extraction blanks were extracted in parallel to detect contamination. Eukaryotic 18S rDNA PCR amplification and high-throughput sequencing DNA extracts were PCR-amplified in triplicate with primers designed to amplify 140-170 bp of eukaryotic 18S ribosomal DNA (Jarman et al. 2013). The forward primer was modified to improve amplification of protists. Table 1. First and second round primers, including MID tags (Xs). ILF_ProSSU3'F_X TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG XXXXXX CACCGCCCGTCGCWMCTACCG ILR_SSU3'R_Y GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG XXXXXX GGTTCACCTACGGAAACCTTGTTACG msqFX AATGATACGGCGACCACCGAGATCTACAC XXXXXXXXXX TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG msqRY CAAGCAGAAGACGGCATACGAGAT XXXXXXXXXX GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG PCR amplifications were performed in two rounds, the first to amplify the 18S region and add sample-specific multiplex-identifier (MID) tags and Illumina sequencing primers, the second to add the P5 and P7 sequencing adapters and additional MIDs. Each reaction mix for the first PCR contained 0.1 µM each of forward and reverse primer, 0.2 µg/µL BSA, 0.2 U Phusion DNA polymerase in 1 x Phusion Master Mix (New England Biolabs, Ipswich, MA, USA) and 1 micro L DNA extract in a total reaction volume of 10 micro L. PCR thermal cycling conditions were initial denaturation at 98 degrees C for 30 secs, followed by 25 cycles of 98 degrees C for 5 secs, 67 degrees C for 20 secs and 72 degrees C for 20 secs, with a final extension at 72 degrees C for 5 min. Replicate PCR products were pooled then diluted 1:10 and Illumina sequencing adapters added in a second round of PCR using the same reaction mix and thermal cycling conditions as the first round, except the concentration of BSA was halved (0.1 micro g/micro L), and the number of cycles was reduced to 10 with an annealing temperature of 55 degrees C. Products from each round of PCR were visualized on 2% agarose gels. Second round PCR products were pooled in equimolar ratios based on band intensity. The pooled products were purified using Agencourt AMPure XP beads (Beckman Coulter, Brea, CA, USA) and the concentration of the library measured using the Qubit dsDNA HS assay on a QUBIT 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA). The pool was diluted to 2 nM and paired-end reads generated on a MiSeq (Illumina, San Diego, CA, USA) with MiSeq Reagent Nano kit vs (300-cycles). Bacterial 16S rDNA PCR amplification and high-throughput sequencing Bioinformatics Reads were sorted by sample-specific MIDs added in the second round PCR using the MiSeq Reporter software. Fastq reads were merged using the -fastq_mergepairs command in USEARCH v8.0.1623 (Edgar 2010). Merged reads were sorted by "internal" 6 bp MID tags, and locus-specific primers trimmed with custom R scripts using the ShortRead package (Morgan et al. 2009), with only reads containing perfect matches to the expected MIDs and primers retained. Reads for all samples were dereplicated and global singletons discarded (-derep_fulllength -minuniquesize 2), and clustered into OTUs with the UPARSE algorithm (Edgar 2013) using the '-cluster_otus' command. Potentially chimeric reads were also discarded during this step. Reads for each sample were then assigned to OTUs (-usearch_global -id .97), and an OTU table generated using a custom R script. Taxonomy was assigned to each OTU using MEGAN version 5.10.5 (Huson et al. 2011) based on 50 hits per OTU generated by BLASTN searches against the NCBI 'nt' database (downloaded August 2015). Default LCA parameters were used, except Min support = 1, Min score = 100, Top percent = 10. Alpha and beta-diversity analyses were performed based on a rarefied OTU table with QIIME v1.8.0 (alpha_rarefaction.py, beta_diversity_through_plots.py, Caporaso et al. 2010). References Caporaso JG, Kuczynski J, Stombaugh J, et al. (2010) QIIME allows analysis of high-throughput community sequencing data. Nature Methods 7, 335-336. Huson DH, Mitra S, Ruscheweyh HJ, Weber N, Schuster SC (2011) Integrative analysis of environmental sequences using MEGAN4. Genome Research 21, 1552-1560. Jarman SN, McInnes JC, Faux C, et al. (2013) Adelie penguin population diet monitoring by analysis of food DNA in scats. PLoS One 8, e82227.

These data come from a set of experiments conducted on the coastal waters near Davis Station in January 2017. The first set of data are from a transect near the Sorsdal glacier and out to sea, to characterise DMSP-mediated phytoplankton bacteria interactions along a salinity gradient. The second data set are from a series of incubation experiments to gain deeper insight into the role of various infochemicals in Antarctic phytoplankton-bacteria relationships. Specifically, DMSP, VitB12, Tryptophan and Methionine. The last data set is derived from two incubation experiments: a short term DMSP addition experiment to look at its uptake and utilisation by the microbial community; and a longer-term (5 day) stable isotope probing experiment to track DMSP through the lower trophic food web.

Two toxicity tests were conducted in the Davis station laboratories in December 2010. Tests used locally collected amphipods of the species Orchomenella pinguides. The tests were conducted by Bianca Sfiligoj, as part of her PhD research (Sfiligoj 2013), with results published in (Sfiligoj et al. 2015). Field and laboratory work was conducted under project AAS 2933, with analysis and write-up completed under AAS 4100 (both projects CI: King). Details are fully described in the published manuscript provided with this data record; file name: Sfiligoj et al 2015_Ecotoxicology.pdf. A subset of the data is also used in Candy et al. 2015 (Filename: Candy et al 2015_Ecotoxicology.pdf). Data files: Test data are provided in the .xlsx file: 'Orchomenella-Tests-Dec 2010.xlsx'. Each worksheet includes a "This worksheet provides…" description in cell A1. Laboratory notebook records are provided in the scanned file: Sfiligoj-LabBookScan-Davis10-11.pdf. In this notebook, tests are labelled LT1 and LT2 (referred to as: amphipod lentil test 1 and 2); with results recorded on pages: 1-19 and 26-28. Data associated with this record has also been presented at: - Candy SG, Sfiligoj BJ, King CK, Mondon JA (2013) Modelling interval-censored survival times in toxicological studies using generalized additive models, The International Biometric Society Australasian Region Conference 2013, Mandurah, Australia, 1-5 December 2013. - Sfiligoj BJ, King CK, Candy SG, Mondon JA (2012) Development of appropriate bioassay and statistical methods for determining survival sensitivities of Antarctic marine biota to metal exposure, 2nd Society for Environmental Toxicology and Chemistry (SETAC) Australasia Conference, Brisbane, Australia, 4-6 July 2012. - Sfiligoj BJ, King CK, Candy SG, Mondon JA (2012) Development of appropriate bioassay and statistical methods for determining survival sensitivities of Antarctic marine biota to metal exposure, Society for Environmental Toxicology and Chemistry (SETAC) World Congress, Berlin, Germany, 20-24 May 2012.

This dataset was collected as part of an honours project by Jessica Wilks at Macquarie University (submitted May 2012). The samples analysed were taken from an expedition conducted by Dr Leanne Armand in 2011 as part of the KEOPS2 mission (KErguelen: compared study of the Ocean and the Plateau in Surface water). During this mission 7 locations (A3-1, A3-2, E1-3, E14W2, NPF-L, R2 and TEW) around the Kerguelen Plateau were sampled for seafloor sediment. This study involved identification of over 50 species of diatoms as part of a species assemblage/ distribution study. A photograph of each diatom encountered in this study is included in the attached plates.

Experimental Set-up: An unreplicated, 6-level, dose-response experiment was conducted on a natural microbial community over a range of pCO2 levels (343, 506, 634, 953, 1140 and 1641 micro atm). Seawater was collected on the 19th November 2014 approximately 1 km offshore from Davis Station, Antarctica (68 degrees 35' S, 77 degrees 58' E) from an area of ice-free water amongst broken fast-ice. The seawater was collected using a thoroughly rinsed 720L Bambi bucket slung beneath a helicopter and transferred into a 7000 L polypropalene reservoir tank. Six 650 L polyethene tanks (minicosms), located in a temperature-controlled shipping container, were immediately filled via teflon lined house via gravity with an in-line 200 micron Arkal filter to exclude metazooplankton. The minicosms were simultaneously filled to ensure they contained the same starting community. The ambient water temperature at time of collection was -1.0 degrees C and the minicosms were maintained at a temperature of 0 degrees C plus or minus 0.5 degrees C. At the centre of each minicosm there was an auger shielded for much of its length by a tube of polythene. This auger was rotated at 15 rpm to gently mix the contents of the tanks. Each minicosm tank was covered with an acrylic air-tight lid to prevent pCO2 off-gasing outside of the minicosm headspace. The minicosm experiment was conducted between the 19th November and the 7th December 2014. Initially, the contents of the tanks were given a day to equibrate to the minicosms. This was followed by a five day acclimation period to increasing pCO2 at low light (0.8 plus or minus 0.2 micro mol m-1 s-1), allowing cell physiology to acclimated to the pCO2 increase (days 1-5). During this period the pCO2 was progressively adjusted over five days to the target level for each tank (343 - 1641 micro atm). Thereafter pCO2 was adjusted daily to maintain the pCO2 level in each treatment (see carbonate chemistry section below). Following acclimation to the various pCO2 treatments light was progressively adjusted to 89 plus or minus 16 micro mol m-2 s-1 at a 19 h light:5 h dark cycle. The community was incubated and allowed to grow for a further 10 days (days 8-18) with target pCO2 adjusted back to target each day (see carbonate chemistry section below). For a more detailed description of minicosm set-up, lighting and carbonate chemistry see; Davidson, A. T., McKinlay, J., Westwood, K., Thomson, P. G., van den Enden, R., de Salas, M., Wright, S., Johnson, R., and Berry, K.:Enhanced CO2 concentrations change the structure of Antarctic marine microbial communities, Mar. Ecol. Prog. Ser., 552, 93-113, 2016. Deppeler, S. L., Petrou, K., Westwood, K., Pearce, I., Pascoe, P., Schulz, K. G., and Davidson, A. T.: Ocean acidification effects on productivity in a coastal Antarctic marine microbial community, Biogeosciences, 2017. Light microscopy sampling and analysis: Samples from each minicosm were collected on days 1, 3, 5, 8, 10, 12, 14, 16 and 18 for microscopic analysis to determine protistan identity and abundance. Approximately 960 mL were collected from each tank, on each day. Samples were fixed with 20 40 mL of Lugol's iodine and allowed to sediment out at 4 degrees C for greater than or equal to 4 days. Once cells had settled the supernatant was gently aspirated till approximately 200 mL remained. This was transferred to a 250 mL measuring cylinder, again allowed to settle (as above), and the supernatant gently aspirated. The remaining 20 mL. This final 20 mL was transferred into a 30 mL amber glass bottle. All samples were stored and transported at 4 degrees C to the Australian Antarctic Division, Hobart, Australia for analysis. Lugols-fixed and sedimented samples were analysed by light microscopy between July 2015 and February 2017. Between 2 to 10 mL (depending on cell-density) of lugols-concentrated samples was placed into a 10 mL Utermohl cylinder (Hydro-Bios, Keil) and the cells allowed to settle overnight. Due to the large variation in size and taxa, a stratified counting procedure was employed to ensure both accurate identification of small cells and representative counts of larger cells. All cells greater than 20 microns were identified and counted at 20x magnification; those less than 20 microns at 40x magnification. For larger cells (greater than 20 microns), 20 randomly chosen fields of view (FOV) at 3.66 x 106 microns2 counted to gain an average cells per L. For smaller cells (less than 20 microns), 20 randomly chosen FOVs at 2.51 x 105 microns2 were counted. Counts were conducted on an Olympus IX 81 microscope with Nomarski interference optics. Identifications were determined using (Scott and Marchant, 2005) and FESEM images. Autotrophic protists were distinguished from heterotrophs via the presence of chloroplasts and based on their taxonomic identity. Electron microscopy sampling and analysis: A further 1 L was taken on days 0, 6, 13 and 18 for analysis by Field Emission Scanning Electron Microscope (FESEM). 25 These samples were concentrated to 5 mL by filtration over a 0.8 micron polycarbonate filter. Cells were resuspended, the concentrate transferred to a glass vial and fixed to a final concentration of 1% EM-grade gluteraldehyde (ProSciTech Pty Ltd). All samples were stored and transported at 4 degrees C to the Australian Antarctic Division, Hobart, Australia for analysis. Gluteraldehyde-fixed samples were prepared for FESEM imaging using a modified polylysine technique (Marchant and Thomas, 30 1983). In brief, a few drops of gluteraldehyde-fixed sample were placed on polylysine coated cover slips and post-fixed with OsO4 (4%) vapour for 30 min, allowing cells to settle onto the coverslips. The coverslips were then rinsed in distilled water and dehydrated through a graded ethanol series ending with emersion in 100% dry acetone before being critically point dried in a Tousimis Autosamdri-815 Critical Point Drier. The coverslips were mounted onto 12.5 mm diameter aluminium stubs and sputter-coated with 7 nm of platinum/palladium in a Cressington 208HRD coater. Imaging of stubs was conducted by JEOL JSM6701F FESEM and protists identified using (Scott and Marchant, 2005). All units are in cells per L estimates from individual field of view counts (FOV) Protistan taxa and functional group descriptions and abbreviations: Autotrophic Dinoflagellate (AD) - including Gymnodinium sp., Heterocapsa and other unidentified autotrophic dinoflagellates Bicosta antennigera (Ba) Chaetoceros (Cha) - mainly Chaetoceros castracanei and Chaetoceros tortissimus but also other Chaetoceros present including C. aequatorialis var antarcticus, C. cf. criophilus, C. curvisetus, C. dichaeta, C. flexuosus, C. neogracilis, C. simplex Choanoflagellates (except Bicosta) (Cho) - mainly Diaphanoeca multiannulata but also Parvicorbicula circularis and Parvicorbicula socialis present in low numbers Ciliates (Cil) - mostly cf. Strombidium but other ciliates also present Discoid Centric Diatoms greater than 40 microns (DC.l) - unidentified centrics of the genera Thalassiosira, Landeria, Stellarima or similar Discoid Centric Diatoms 20 to 40 microns (DC.m) - unidentified centrics of the genera Thalassiosira, Landeria, Stellarima or similar Discoid Centric Diatoms less than 20 microns (DC.s) - unidentified centrics of the genera Thalassiosira Euglenoid (Eu) - unidentified Fragilariopsis greater than 20 microns (F.l) - mainly Fragilariopsis cylindrus, some Fragilariopsis kerguelensis and potentially some Fragilariopsis curta present in very low numbers Fragilariopsis less than 20 microns (F.s) - mainly Fragilariopsis cylindrus, and potentially some Fragilariopsis curta present in very low numbers Heterotrophic Dinoflagellates (HD) - including Gyrodinium glaciale, Gyrodinium lachryma, other Gyrodinium sp., Protoperidinium cf. antarcticum and other unidentified heterotrophic dinoflagellates Landeria annulata (La) Other Centric Diatoms (OC) - Corethronb pennatum, Dactyliosolen tenuijuntus, Eucampia antarctica var recta, Rhizosolenia imbricata and other Rhizosolenia sp. Odontella (Od) - Odontella weissflogii and Odontella litigiosa Other Flagellates (OF) - Dictyocha speculum, Chrysochromulina sp., unknown haptophyte, Phaeocystis antarctica (flagellate and gamete forms), Mantoniella sp., Pryaminmonas gelidicola, Triparma columaceae, Triparma laevis subsp ramispina, Geminigera sp., Bodo sp., Leuocryptos sp., Polytoma sp., cf. Protaspis, Telonema antarctica, Thaumatomastix sp. and other unidentified nano- and picoplankton Other Pennate Diatoms (OP) - Entomonei kjellmanii var kjellmanii, Navicula gelida var parvula, Nitzschia longissima, other Nitzschia sp., Plagiotropus gaussi, Pseudonitzschia prolongatoides, Synedropsis sp. Phaeocystis antarctica (Pa) - colonial form only Proboscia truncata (Pro) Pseudonitzschia subcurvata (Ps) Pseudonitzschia turgiduloies (Pt) Stellarima microtrias (Sm) Thalassiosira antarctica (Ta) Thalassiosira ritscheri (Tr) *.se = standard error for mean cell per L estimate ie. Tr.se = standard error for the mean cells per L for Thalassiosira ritscheri based on individual FOV estimates as described in methods above. Davis Station Antarctica Experiment conducted between 19th November and 7th December 2014.

An unreplicated, six-level dose-response experiment was conducted using 650 L incubation tanks (minicosms) adjusted to fugacity of carbon dioxide (fCO2) from 343 to 11641 uatm. The minicosms were filled with near-shore water from Prydz Bay, East Antarctica and the protistan composition and abundance was determined by microscopy analysis of samples collected during the 18 day incubation. Abundant taxa with low variance were examined separately, but rare taxa with high variance were combined into functional groups (descriptions below). Cluster analyses and ordinations were performed on Bray-Curtis resemblance matrixes formed from square-root transformated abundance data. This transformation was assessed as appropriate for reducing the influence of abundance species, as judged from a one-to-one relationship between observed dissimilarities and ordination distances (ie. Shepard diagram, not shown). The Bray-Curtis metric was used as it is recommended for ecological data due to its treatment of joint absences (ie. these do not contribute towards similarity), and giving more weight to abundant taxa rather than rare taxa. The data days 1 to 8 and then days 8 to 18 were analysed separately to distinguish community structure in the acclimation period and in the exponential growth phase during the incubation period of the experiment. Hierarchical agglomerative cluster analyses, based on the Bray-Curtis resemblance matrix, was performed using group-average linkage. Significantly different clusters of samples were determined using SIMPROF (similarity profile permutations method) with an alpha value of 0.05 and based on 1000 permutations. An unconstrained ordination by non-metric multidimensional scaling (nMDS) was performed on the resemblance matrix with a primary (`weak') treatment of ties. This was repeated over 50 random starts to ensure a globally optimal solution according to . Clusters are displayed in the nMDS using colour. Weighted average of sample scores are shown in the nMDS to show the approximate contribution of each species to each sample. The assumption of a linear trend for predictors within the ordination was checked for each covariate, and in all instances was found to be justified. A constrained canonical analysis of principal coordinates (CAP) was conducted according to the Vegan protocol using the Bray-Curtis resemblance matrix. This analysis was used to assess the significance of the environmental covariates, or constraints, in determining the microbial community structure. Unlike the nMDS ordination, the CAP analysis uses the resemblance matrix to partition the total variance in the community composition into unconstrained and constrained components, with the latter comprising only the variation that can be attributed to the constraining variables, fCO2, Si, P and NOx. Random reassignment of sample resemblance was performed over 199 permutations to compute the pseudo-F statistic as a measure of significance of each environmental constraint in the structural change of the microbial community. A forward selection strategy was used to choose a minimum subset of significant constraints that still account for the majority of the variation within the microbial community. All analysis were performed using R v1.0.136 and the add-on package vegan v2.4-2. Protistan taxa and functional group descriptions and abbreviations: Autotrophic Dinoflagellate (AD) - including Gymnodinium sp., Heterocapsa and other unidentified autotrophic dinoflagellates Bicosta antennigera (Ba) Chaetoceros (Cha) - mainly Chaetoceros castracanei and Chaetoceros tortissimus but also other Chaetoceros present including C. aequatorialis var antarcticus, C. cf. criophilus, C. curvisetus, C. dichaeta, C. flexuosus, C. neogracilis, C. simplex Choanoflagellates (except Bicosta) (Cho) - mainly Diaphanoeca multiannulata but also Parvicorbicula circularis and Parvicorbicula socialis present in low numbers Ciliates (Cil) - mostly cf. Strombidium but other ciliates also present Discoid Centric Diatoms greater than 40 microns (DC.l) - unidentified centrics of the genera Thalassiosira, Landeria, Stellarima or similar Discoid Centric Diatoms 20 to 40 microns (DC.m) - unidentified centrics of the genera Thalassiosira, Landeria, Stellarima or similar Discoid Centric Diatoms less than 20 microns (DC.s) - unidentified centrics of the genera Thalassiosira Euglenoid (Eu) - unidentified Fragilariopsis greater than 20 microns (F.l) - mainly Fragilariopsis cylindrus, some Fragilariopsis kerguelensis and potentially some Fragilariopsis curta present in very low numbers Fragilariopsis less than 20 microns (F.s) - mainly Fragilariopsis cylindrus, and potentially some Fragilariopsis curta present in very low numbers Heterotrophic Dinoflagellates (HD) - including Gyrodinium glaciale, Gyrodinium lachryma, other Gyrodinium sp., Protoperidinium cf. antarcticum and other unidentified heterotrophic dinoflagellates Landeria annulata (La) Other Centric Diatoms (OC) - Corethronb pennatum, Dactyliosolen tenuijuntus, Eucampia antarctica var recta, Rhizosolenia imbricata and other Rhizosolenia sp. Odontella (Od) - Odontella weissflogii and Odontella litigiosa Other Flagellates (OF) - Dictyocha speculum, Chrysochromulina sp., unknown haptophyte, Phaeocystis antarctica (flagellate and gamete forms), Mantoniella sp., Pryaminmonas gelidicola, Triparma columaceae, Triparma laevis subsp ramispina, Geminigera sp., Bodo sp., Leuocryptos sp., Polytoma sp., cf. Protaspis, Telonema antarctica, Thaumatomastix sp. and other unidentified nano- and picoplankton Other Pennate Diatoms (OP) - Entomonei kjellmanii var kjellmanii, Navicula gelida var parvula, Nitzschia longissima, other Nitzschia sp., Plagiotropus gaussi, Pseudonitzschia prolongatoides, Synedropsis sp. Phaeocystis antarctica (Pa) - colonial form only Proboscia truncata (Pro) Pseudonitzschia subcurvata (Ps) Pseudonitzschia turgiduloies (Pt) Stellarima microtrias (Sm) Thalassiosira antarctica (Ta) Thalassiosira ritscheri (Tr) *.se = standard error for mean cell per L estimate ie. Tr.se = standard error for the mean cells per L for Thalassiosira ritscheri based on individual FOV estimates as described in methods above.

Radiolarian data from IN2017_V01 These data were generated by Kelly-Anne Lawler (corresponding author, kelly-anne.lawler@anu.edu.au) with taxonomic assistance from Dr Giuseppe Cortese. These data are based on samples collected during voyage IN2017_V01 of the RV Investigator, co-chief scientists, Leanne Armand and Phil O’Brien. The IN2017-V01 post-cruise report is available through open access via the e-document portal through the ANU library. https://openresearch-repository.anu.edu.au/handle/1885/142525 The preferred citation is: L.K. Armand, P.E. O’Brien and On-board Scientific Party. 2018. Interactions of the Totten Glacier with the Southern Ocean through multiple glacial cycles (IN2017-V01): Post-survey report, Research School of Earth Sciences, Australian National University: Canberra, http://dx.doi.org/10.4225/13/5acea64c48693 Samples for radiolarian analysis were collected on board immediately after core recovery. Samples were air dried at ambient temperature (~21 degrees C), and their processing in preparation for microscopy was based on the method of Cortese and Prebble (2015). Cover slips were adhered to the slides using Canada Balsam and slides were observed using Olympus BH-2 inverted light microscope at up to 400x magnification. Slides were first counted to determine absolute radiolarian abundance (ARA) and, for samples where ARA was high enough, more than 400 individuals were identified per sample to species/subspecies or genus level. Taxonomic nomenclature used while preparing the dataset was per Lazarus et al. (2015) with additional clarification sought from the World Register of Marine Species (WoRMS Editorial Board, 2018) and radiolaria.org (radiolaria.org, 2018). Station_core Longitude Latitude C013_KC05 119.0183 -64.6538 C022_KC11 120.049 -65.1313 These data were collected to provide palaeoceanographic information. Cortese, G., and Prebble, J. (2015). A radiolarian-based modern analogue dataset for palaeoenvironmental reconstructions in the southwest Pacific. Marine Micropaleontology, 118, 34-49. WoRMS Editorial Board, (2018). World Register of Marine Species. Available from http://www.marinespecies.org at VLIZ. Lazarus, D. B., Suzuki, N., Caulet, J.-P., Nigrini, C., Goll, I., Goll, R., Dolven, J.K. Diver, P. and Sanfilippo, A., (2015). An evaluated list of Cenozic-Recent radiolarian species names (Polycystinea), based on those used in the DSDP, ODP and IODP deep-sea drilling programs. Zootaxa, 3999(3), 310-333. radiolaria.org, 2018. radiolaria.org, (http://www.radiolaria.org/) Kelly-Anne Lawler and Giuseppe Cortese unpublished data

Samples were collected using a prototype basket sampler that concentrated phytoplankton from the underway water supply in the OG lab onboard Aurora Australis. The sampler filtered water during transit, and the distance travelled and the approximate volume of water sampled was recorded. A phytoplankton net tow was collected at each station. The majority of imaging was undertaken using a Leica DMLB2 microscope with phase contrastand Leica ICC50 digital in body camera. Samples were preserved with either glutaraldhyde or Lugols iodine for later examination as well. Details of sample collected are included in the Voyage sample log.