Metadata record for data from AAS Project 3127 See the link below for public details on this project. Bacteria in marine environments have been found to be able to partially support growth by using light to generate energy in a non-photosynthetic process. This is possible due to a special protein called proteorhodopsin. It is hypothesised that formation of proteorhodopsin has evolved to cope with extreme lack of nutrients. The goal is to determine the significance of proteorhodopsins in the productivity of Southern Ocean microbial communities. This includes determination of proteorhodopsin distribution, presence in seawater and sea-ice samples using molecular techniques, and determination of how important environmental factors (light, nutrient availability, temperature) may drive its synthesis and activity. Taken from the 2009-2010 Progress Report Project objectives: 1. Determine incidence of proteorhodopsins in Southern Ocean water and sea-ice derived bacteria (Year 1) and other Antarctic aquatic environments (Year 2 and 3). 2. Determine whether proteorhodopsins contribute to food web energy budgets. 3. Determine how proteorhodopsin contributions are influenced by physicochemical features of the environment including light availability, temperature and nutrients. Progress against objectives: Proteorhodopsin is a light harvesting membrane protein that has been found recently to occur in 30-70% of marine bacterial cells. The role of this protein is uncertain but believed to be highly important in energy and nutrient budgets in food webs as it is capable of generating a proton gradient. Amongst a cultured set of Antarctic bacteria we have discovered many PR-producing species. These include many Antarctic lake species. Research is ongoing to determine affect of light on the physiology of these bacteria in particular the genome sequenced species Psychroflexus torquis, an extremely cold-adapted resident of Antarctic sea-ice. 1. Completed screen of Antarctic bacterial collection for proteorhodopsin (PR) genes using PCR-based approaches 2. Proteomic-based analysis of PR-bearing sea-ice species Psychroflexus torquis is currently ongoing 3. Light/dark defined growth-based experiments determining conditions leading to biomass enhancement are ongoing

In March 2018, 23 environmental DNA (eDNA) samples (2 L of filtered seawater) were collected between Hobart, Tasmania and subantarctic Macquarie Island. These samples were processed using six different genetic metabarcoding markers targeting different taxonomic groups within the metazoan clade: A broad cytochrome c oxidase subunit I (COI) marker targeting all metazoans, and five different 16S markers targeting fish, cephalopods and crustaceans (one degenerate marker), fish (two markers of different lengths), cephalopods (one marker) and crustaceans (one marker). The aim of this study was to identify an ideal set of molecular markers to identify as many metazoan species as possible from small environmental samples, with a particular focus on vertebrates, crustaceans and cephalopods. The data and methods are described in the word file "V4 2018 eDNA group specific markers.docx", results are summarised in the excel file "Marker.detection.xlsx" and additional sample information is in the excel files "2018_11_07_eDNA-sample-info.xls" and "sample.map.csv". Each genetic marker used in this study has its own folder, containing the raw FASTQ sequencing data, the processed FASTA sequencing data, the bioinformatics processing pipeline, the zOTU fasta file, BLAST output, MEGAN output and curated zOTU table. For further explanations please refer to the word file "V4 2018 eDNA group specific markers.docx".

Metadata record for data from ASAC Project 2307 See the link below for public details on this project. ---- Public Summary from Project ---- The project investigates microbial life in the Southern Ocean. The studies will investigate two areas - the role of bacteria in the regeneration of the important nutrient silica via decomposition of planktonic biomass and to assess the importance of prokaryotic polyunsaturated fatty acid (PUFA) entering the marine food web from natural communities in Antarctic sea ice and the Southern Ocean. Project objectives: 1. Investigate the role of bacteria in the colonisation and decomposition of phytoplankton and concomitant redispersal of silica from phytoplankton in seawater of the Southern Ocean at various different latitudes. 2. Validate real-time PCR (5-prime nuclease PCR assay) for rapid quantification of key bacterial found in seawater to determine their association with phytoplankton decomposition and silica redispersal. Significance: Recent studies (Bidle and Azam, 1999) demonstrate that much silica regeneration in seawater is due to bacterial enzymatic activity and that diatom decomposition and silica release is highly accelerated in the presence of an active colonising bacterial population. The formation of bacterial biofilms and production of extracellular enzymes on phytoplanktic detritus and aggregates appears to lead to the direct breakdown of proteins and polysaccharides which hold together the diatom frustules. In the Southern Ocean this process could be significant as the foodweb there is sustained by phytoplanktonic (mostly diatom) primary productivity (Bunt 1963) whether it be in sea-ice or in the pelagic zone. If silica redispersal does not occur diatoms would instead eventually become buried in sediment with silica supplies becoming limited, except that supplied by aeolian and terrigenous input. In the marine environment half of primary-produced organic matter is degraded by bacteria (Cole et al., 1988). Thus the bacterial decomposition of diatom biomass and subsequent release of dissolved silica should be an important and relatively rapid process in Southern Ocean waters. At this stage there is still limited data on the role of bacteria in regeneration of silica in the overall marine environment. The study of Bidle and Azam (1999) examined seawater off of California and mostly examined the process itself. Currently, the role of specific bacteria is being examined by Kay Bidle (personal communication) and John Bowman is supplying various marine bacteria to assess this. In the proposed study we wish to examine the role of bacteria in the Southern Ocean in the decomposition of diatom biomass, rate of release of dissolved silica and bacterial groups involved in the process. This research should reveal some fundamental knowledge on a integral role of bacteria in Southern Ocean ecosystems. In order to assess the bacterial role in silica redispersal we wish to use three molecular ecological techniques: fluorescent in situ hybridisation (FISH), denaturing gradient gel electrophoresis (DGGE) and real-time PCR. FISH and DGGE analysis are well established in John Bowmans laboratory and are being used routinely for analysis of Antarctic and Tasmanian natural samples (seawater and sediment). The real-time PCR analysis which can be used as a sensitive quantitative assay for bacterial populations in natural samples is currently in development using a recently purchased Rotorgene (Corbett Research) instrument. The method has been used to great effect in measuring rapidly bacterial populations in seawater (eg., Suzuki et al. 2000). Using these methods will allow us to accurately measure changes in bacterial populations during colonisation and decomposition of the diatom biomass during the silica redispersal experiments. There are two data files associated with this project. Part 1: Total of 9 files: File 1. Seawater sample data - information from two cruises in 2000 and 2001 - includes position of sample, types of sample, temperature and analyses performed subsequently. File 2. 16S rRNA gene sequences derived from Southern ocean seawater bacterial isolates. Sequences are all deposited in the GenBank nucleotide database and are in FASTA format. File 3. 16S rRNA gene sequences derived from denaturing gradient gel electrophoretic gel slices via extraction, PCR and cloning. Sequences are all deposited in the GenBank nucleotide database and are in FASTA format. File 4. Flavobacteria abundance in Southern Ocean samples on the basis of depth. Abundance determined using fluorescent insitu hybridisation using universal bacterial probe EUB338 and flavobacteria specific probe. Details of sites analysed are included in the seawater sample file. File 5. Flavobacteria abundance in Southern Ocean samples on the basis of latitude (transect from 47 S to 63 S). Abundance determined using fluorescent insitu hybridisation using universal bacterial probe EUB338, alphaproteobacteria, gammaproteobacteria and flavobacteria specific probe. Total count of bacteria was determined by epifluorescence using DAPI. Details of sites analysed are included in the seawater sample file. File 6. Nutrient and chlorophyll a data for samples studied (see seawater sample file) including nitrate, phosphate and silica. File 7. Bacterial isolate information including strain designations, site location, and identification to genus level. File 8. . Bacterial isolate fatty acid data for strains designated as novel in bacterial isolate information file. Fatty acids determined using GC-MS analytical methods. File 9. Bacterial isolate phenotypic data for strains designated as novel in bacterial isolate information file. Includes morphological, physicochemical, biochemical and nutritional profile data. Part 2: Total of 4 files: File 1. 16S rRNA gene sequences derived from denaturing gradient gel electrophoretic (DGGE) gel slices via extraction, PCR and cloning. DGGE analysis performed on samples analysed over 30 days from 20 litre microcosms derived from southern seawater to which was added 10 mg sterile diatom detritus derived from axenic Nitszchia closterium. Sequences are all deposited in the GenBank nucleotide database and are in FASTA format. File 2. Flavobacteria abundance in Southern Ocean seawater microcosms over 30 days. Abundance determined using real-time PCR using universal bacterial and flavobacteria specific PCR primers. File 3. Bacterial mediated silica release data from Southern Ocean seawater microcosms over 30 days. Includes non-detritus amended controls that indicate the natural level of of seawater silica. Silica analysis performed by a chemical procedure. File. 4. Seawater sample data obtained during 2001 indicating the sites for seawater used for creating 20 l microcosms and used to assess silica release by bacteria from diatom detritus.

On the return leg of the V1 2019 resupply voyage from Davis station to Hobart on the RSV Aurora Australis paired, open ocean environmental DNA (eDNA) samples were taken at 29 locations along the voyage. Sample names, sample coordinates as well as a range of environmental variables at each location are listed in file ‘V1 2019 Samples.xlsx’. Each sample pair consisted of one 2 L sample filtered through a 0.45 μm pore size filter, and one 12 L sample filtered through a 20 μm pore size filter. Filtering happened on board immediately after sampling. Filters of the 2 L samples were halved and stored in separate tubes, then immediately frozen at -80 ˚C. Filters of the 12 L samples were stored whole and also frozen at -80 ˚C. DNA of all samples was extracted at the specialised lab ‘eDNA frontiers’ located at Curtin University, WA using DNeasy Blood and Tissue Kits, and the extracted DNA sent back to the genetics lab at the Australian Antarctic Division (AAD). Several metabarcoding approaches were conducted to survey metazoan biodiversity present in these samples: - A marker targeting the mitochondrial gene cytochrome c oxidase I (COI) using metazoan specific primers (Forward primer mlCOIintF: GGWACWGGWTGAACWGTWTAYCCYCC; reverse primer jgHCO2198). This marker was used twice, using identical PCR conditions (95 °C for 10 min, a 16 cycle touchdown phase (62 °C -1 °C per cycle), followed by 25 cycles with an annealing temperature of 46 °C (total of 41 cycles), and a final extension at 72 °C for 5 min). : once using a two PCR step method, using MID tagged primers in the first round of PCR, and MID tagged Illumina sequencing adapters in the second round of PCR (second round PCR conditions using MID tagged Illumina sequencing adapters with this and all other markers listed below were: 95 °C for 10 min, 10 cycles of 95 °C for 30 sec, 55 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘COI dual tagged’. The second method used a one round PCR with fusion tagged primers, conducted at Curtin University and sequenced there as well. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘COI fusion tagged’. - A marker targeting the mitochondrial 16S rRNA gene, using fish specific primers (Forward primer Fish_F: GACGAGAAGACCCYRTGRAG; reverse primer Fish_R GACGAGAAGACCCYRTGRAG) with the following PCR conditions: 95 °C for 10 min, 45 cycles of 95 °C for 30 sec, 60 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. PCR were conducted in two steps as described above (first round PCR with MID tagged markers, second round PCR with MID tagged Illumina sequencing adapters). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Fish’. - A marker targeting the mitochondrial 16S rRNA gene, using mammal specific primers (Forward primer Mammal_F: CAATTTNGGTTGGGGTGA; reverse primer Mammal_R GGATTGCGCTGTTATCCCTA) with the following PCR conditions: 95 °C for 10 min, 45 cycles of 95 °C for 30 sec, 56 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. PCR were conducted in two steps as described above (first round PCR with MID tagged markers, second round PCR with MID tagged Illumina sequencing adapters). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Mammal’. - A marker targeting the mitochondrial 16S rRNA gene, using krill specific primers (Forward primer Crust_F: GTGACGATAAGACCCTATA; reverse primer Crust_R ATTACGCTGTTATCCCTAAAG) with the following PCR conditions: 95 °C for 10 min, 45 cycles of 95 °C for 30 sec, 56 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. PCR were conducted in two steps as described above (first round PCR with MID tagged markers, second round PCR with MID tagged Illumina sequencing adapters). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Krill’. Using the fish and mammal specific metabarcoding markers, we detected the presence of several fish and marine mammal species in a subset of eDNA samples. These markers were tested again with a number of additional markers: - A marker targeting the mitochondrial control region, using whale specific primers (Forward primer Dloop_1.5_F: CCACAGTACTATGTCCGTATT; Reverse primer Dlp4_R: GCGGGWTRYTGRTTTCACG) with the following first round PCR conditions: 95 °C for 10 min, 40 cycles of 95 °C for 30 sec, 54 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. First round markers were untagged. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Whale DLoop 1.5’. - A marker targeting the mitochondrial control region, using whale specific primers (Forward primer Dloop_10_F: TCACCCAAAGCTGRARTTCTA; Reverse primer Dlp4_R: GCGGGWTRYTGRTTTCACG) with the following first round PCR conditions: 95 °C for 10 min, 40 cycles of 95 °C for 30 sec, 54 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. First round markers were untagged. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Whale DLoop 10’. - A marker targeting the mitochondrial control region, using a nested PCR approach with whale specific primers (First round forward primer Dloop_1.5_F: CCACAGTACTATGTCCGTATT; Reverse primer Dloop_5_R: CCATCGWGATGTCTTATTTAAGRGGAA. Second round forward primer Dloop_1.5_F: CCACAGTACTATGTCCGTATT, reverse primer Dlp4_R: GCGGGWTRYTGRTTTCACG) with the following first round PCR conditions: 95 °C for 10 min, 40 cycles of 95 °C for 30 sec, 54 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min, and identical second round PCR conditions with the exception of only 20 cycles of amplification. First round markers as well as Illumina adaptors were MID tagged. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Whale DLoop Nested’. - A marker targeting the mitochondrial 16S rRNA gene using vertebra specific, MID tagged primers (Forward primer MarVer3_F: AGACGAGAAGACCCYRTG; reverse primer MarVer3_R: GGATTGCGCTGTTATCCC) with the following first round PCR conditions: 95 °C for 10 min, 40 cycles of 95 °C for 30 sec, 54 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Vertebra’.