Access database containing biological and environmental data collected by the Australian Antarctic Division, Human Impacts Benthic Biodiversity group.

Four camera tow transects were completed on the upper slope during survey IN2017_V01 using the Marine National Facility’s Deep Tow Camera. This system collected oblique facing still images with a Canon – 1DX camera and high definition video with a Canon – C300 system. Four SeaLite Sphere lights provided illumination and two parallel laser beams 10 cm apart provided a reference scale for the images. This dataset presents results from the analysis of the still imagery. All camera tows were run at a ship speed over the ground of approximately 2 knots. Several sensors were attached to the towed body, including a SBE 37 CTD for collection of salinity, temperature and pressure data, a Kongsberg Mesotech altimeter and a Sonardynne beacon to record the location of the towed body. Transects were run downslope from the continental shelf break, with images analysed over a depth range of ~495 m to 670-725 m. Biota and substrates were characterised for every fifth image according to the CATAMI image classification scheme (Collaborative and Automated Tools for Analysis of Marine Imagery, Althaus et al., 2015). Images were loaded into the online platform SQUIDLE+ for analysis. Biota were counted as presence/absence of all visible biota for each image. Percent biological cover and substrate type for the whole image was calculated based on analysis of 30 random points across each image. Percent cover calculations were standardised according to the proportion of scored points on each image, excluding those that were too dark to classify. A total of 203 images were analysed. Images are available from: http://dap.nci.org.au/thredds/remoteCatalogService?catalog=http://dapds00.nci.org.au/thredds/catalog/fk1/IN2017_V01_Sabrina_Seafloor/catalog.xml

Refer to antFOCE report section 2.3 for deployment, sampling and analysis details. https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 The download file contains an Excel workbook with a series of data spreadsheets - one for each of the Onset Hoboware Tidbit v2 (UTBI-001) temperature loggers that were attached to the outside of various pieces of the underwater experimental infrastructure across the antFOCE site. A Notes spreadsheet is also included with information relevant to the data. Background The antFOCE experimental system was deployed in O'Brien Bay, approximately 5 kilometres south of Casey station, East Antarctica, in the austral summer of 2014/15. Surface and sub-surface (in water below the sea ice) infrastructure allowed controlled manipulation of seawater pH levels (reduced by 0.4 pH units below ambient) in 2 chambers placed on the sea floor over natural benthic communities. Two control chambers (no pH manipulation) and two open plots (no chambers, no pH manipulation) were also sampled to compare to the pH manipulated (acidified) treatment chambers. Details of the antFOCE experiment can be found in the report – "antFOCE 2014/15 – Experimental System, Deployment, Sampling and Analysis". This report and a diagram indicating how the various antFOCE data sets relate to each other are available at: https://data.aad.gov.au/metadata/AAS_4127_antFOCE_Project4127

Sampling strategy: Samples from trawls or sledges are sieved on the trawl deck then sorted in the wet lab per taxonomic group. Sorting may vary from high taxonomic levels (order, family) to specific ones according to expertise on board. For some taxa, sampling includes: up to 10 voucher specimens with a unique batch number; photos; tissue samples in 80% ethanol for DNA analysis (Barcoding and Phylogeny); 30 samples minimum for population genetics (for abundant species); sampling for isotopic measures; fish chromosomes preparations; primary fish cell lines and cryopreservation of fish tissues for permanent cell lines The database was intended to contain information about stations, events, gear, all material collected and associated samples listed above. currently only contains information on material collected and samples. Data was recorded on log sheets then transcribed into an Oracle database called cabo. Tailor made user interace for entering data. No export functionality. SQL database dump has been provided but there was no-one on the voyage to elaborate on the structure, this was promised post voyage along with some simple data exports to match the log sheets, so we have access to the data without the unfriendly database.

This dataset is a document describing the Ctenophores of the Southern Ocean. It lists all the known species and with illustrated diagrams provides a guide to their taxonomic identification. The document is available for download as a pdf from the provided URL.

This dataset is intended for general use in spatial planning and management to identify areas where benthic marine assemblages are likely to differ from each other in the Southern Ocean. We achieve this by using a hierarchical spatial classification of ecoregions, bathomes and environmental types. Ecoregions are defined according to available data on biogeographic patterns and environmental drivers on dispersal. Bathomes are identified according to depth strata defined by species distributions. Environmental types are uniquely classified according to the geomorphic features found within the bathomes in each ecoregion. This circum-Antarctic map of environmental types can be used to support spatial management aimed at conserving benthic biodiversity across the entire Southern Ocean. The study area spans the region managed by the Commission for the Conservation of Antarctic Marine Living Resources (CCAMLR). The northern boundary of this region is a line approximating the location of the Polar Front. The southern boundary was defined as the northern edge of the permanent ice shelf of the Antarctic continent. The shapefile can be used to identify three levels of the hierarchical classification (see Fig. 1 of Douglass et al., 2014): 1) Level 1: Ecoregions 2) Level 2b: Geomorphic features nested in each ecoregion 3) Level 3: Environmental Types The dataset cannot be used to analyse a level 2a nesting since for some geomorphic features (e.g. seamounts and canyons) the nested bathomes were combined when generating environmental types. If a level 2a nesting is required please contact douglass.lucinda@gmail.com The shapefile contains ten fields: EcoID- Abbreviated Level 1 benthic ecoregion names Ecoregion- Level 1 benthic ecoregion names Geomorph2- Geomorphic features BathID- Bathome identification number which can be used to sort the depth classes Bathome2 - Bathome EcoGeo- Level 2b nesting of geomorphic features in each ecoregion EnvTyp- Level 3 environmental types GeoClsID- Geomorphic class identification number GeoCls- Geomorphic classes Sqkm- Area in square kilometers

This metadata record contains an Excel spreadsheet with Operational Taxonomic Units (OTUs) gained from Eukaryotic 18S rDNA PCR amplification and high-throughput sequencing of samples from Biofilm slides deployed as part of the antFOCE experiment in the austral summer of 2014/15 at Casey station, East Antarctica. Refer to antFOCE report section 4.5.3 for deployment, sampling and analysis details. https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 Sampling design 2 trays of 8 horizontal standard glass microscope slides (72 x 25 mm) per chamber. Four of the glass slides were scored with a diamond pencil approximately 18 mm from the right hand end of the slide and deployed scored side up. The remaining four slides were unmodified. Slides were sampled at: - Tmid - one tray per chamber / open plot. The sampled try was repopulated with fresh slides and redeployed - Tend – 2 slides trays per chamber / open plot. Sampling procedure After 31 days deployment, 1 slide tray per chamber / open plot was sampled. At Tend both trays in each chamber / open plot were sampled. To minimize disturbance while being raised to the surface, each tray was removed from the tray holder by divers and placed in a seawater filled container with a lid. On the surface, slides were removed from the tray using ethanol sterilized forceps. The four unscoured slides per chamber / open plot were placed in a plastic microscope slide holder with a sealable lid. The scoured slides were placed individually in 70 ml plastic sample jars. Lab procedure - Casey The slide holder (4 unscoured slides) from each chamber / open plot was frozen at -20C immediately upon return to the lab. The scoured slides were preserved in sea water containing 1% final concentration glutaraldehyde in separate jars. Preservation Issue: Scoured slides were not refrigerated, either at Casey, during RTA or in Kingston before the 26th Nov 2015, when they were transferred to the 4C Cold Store. antFOCE Background The antFOCE experimental system was deployed in O’Brien Bay, approximately 5 kilometres south of Casey station, East Antarctica, in the austral summer of 2014/15. Surface and sub-surface (in water below the sea ice) infrastructure allowed controlled manipulation of seawater pH levels (reduced by 0.4 pH units below ambient) in 2 chambers placed on the sea floor over natural benthic communities. Two control chambers (no pH manipulation) and two open plots (no chambers, no pH manipulation) were also sampled to compare to the pH manipulated (acidified) treatment chambers. Details of the antFOCE experiment can be found in the report – "antFOCE 2014/15 – Experimental System, Deployment, Sampling and Analysis". This report and a diagram indicating how the various antFOCE data sets relate to each other are available at: https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 AntFOCE biofilm DNA methods Laurence Clarke, Shane Powell, Bruce Deagle DNA extraction The biofilm was removed from the top of each slide with a cotton swab and DNA extracted directly from the swab using the MoBio PowerBiofilm DNA isolation kit following the manufacturer’s protocol. Extraction blanks were extracted in parallel to detect contamination. Eukaryotic 18S rDNA PCR amplification and high-throughput sequencing DNA extracts were PCR-amplified in triplicate with primers designed to amplify 140-170 bp of eukaryotic 18S ribosomal DNA (Jarman et al. 2013). The forward primer was modified to improve amplification of protists. Table 1. First and second round primers, including MID tags (Xs). ILF_ProSSU3'F_X TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG XXXXXX CACCGCCCGTCGCWMCTACCG ILR_SSU3'R_Y GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG XXXXXX GGTTCACCTACGGAAACCTTGTTACG msqFX AATGATACGGCGACCACCGAGATCTACAC XXXXXXXXXX TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG msqRY CAAGCAGAAGACGGCATACGAGAT XXXXXXXXXX GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG PCR amplifications were performed in two rounds, the first to amplify the 18S region and add sample-specific multiplex-identifier (MID) tags and Illumina sequencing primers, the second to add the P5 and P7 sequencing adapters and additional MIDs. Each reaction mix for the first PCR contained 0.1 µM each of forward and reverse primer, 0.2 µg/µL BSA, 0.2 U Phusion DNA polymerase in 1 x Phusion Master Mix (New England Biolabs, Ipswich, MA, USA) and 1 micro L DNA extract in a total reaction volume of 10 micro L. PCR thermal cycling conditions were initial denaturation at 98 degrees C for 30 secs, followed by 25 cycles of 98 degrees C for 5 secs, 67 degrees C for 20 secs and 72 degrees C for 20 secs, with a final extension at 72 degrees C for 5 min. Replicate PCR products were pooled then diluted 1:10 and Illumina sequencing adapters added in a second round of PCR using the same reaction mix and thermal cycling conditions as the first round, except the concentration of BSA was halved (0.1 micro g/micro L), and the number of cycles was reduced to 10 with an annealing temperature of 55 degrees C. Products from each round of PCR were visualized on 2% agarose gels. Second round PCR products were pooled in equimolar ratios based on band intensity. The pooled products were purified using Agencourt AMPure XP beads (Beckman Coulter, Brea, CA, USA) and the concentration of the library measured using the Qubit dsDNA HS assay on a QUBIT 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA). The pool was diluted to 2 nM and paired-end reads generated on a MiSeq (Illumina, San Diego, CA, USA) with MiSeq Reagent Nano kit vs (300-cycles). Bacterial 16S rDNA PCR amplification and high-throughput sequencing Bioinformatics Reads were sorted by sample-specific MIDs added in the second round PCR using the MiSeq Reporter software. Fastq reads were merged using the -fastq_mergepairs command in USEARCH v8.0.1623 (Edgar 2010). Merged reads were sorted by "internal" 6 bp MID tags, and locus-specific primers trimmed with custom R scripts using the ShortRead package (Morgan et al. 2009), with only reads containing perfect matches to the expected MIDs and primers retained. Reads for all samples were dereplicated and global singletons discarded (-derep_fulllength -minuniquesize 2), and clustered into OTUs with the UPARSE algorithm (Edgar 2013) using the '-cluster_otus' command. Potentially chimeric reads were also discarded during this step. Reads for each sample were then assigned to OTUs (-usearch_global -id .97), and an OTU table generated using a custom R script. Taxonomy was assigned to each OTU using MEGAN version 5.10.5 (Huson et al. 2011) based on 50 hits per OTU generated by BLASTN searches against the NCBI 'nt' database (downloaded August 2015). Default LCA parameters were used, except Min support = 1, Min score = 100, Top percent = 10. Alpha and beta-diversity analyses were performed based on a rarefied OTU table with QIIME v1.8.0 (alpha_rarefaction.py, beta_diversity_through_plots.py, Caporaso et al. 2010). References Caporaso JG, Kuczynski J, Stombaugh J, et al. (2010) QIIME allows analysis of high-throughput community sequencing data. Nature Methods 7, 335-336. Huson DH, Mitra S, Ruscheweyh HJ, Weber N, Schuster SC (2011) Integrative analysis of environmental sequences using MEGAN4. Genome Research 21, 1552-1560. Jarman SN, McInnes JC, Faux C, et al. (2013) Adelie penguin population diet monitoring by analysis of food DNA in scats. PLoS One 8, e82227.

Underwater video samples were obtained from the Deep Underwater Camera II (DUCII) system. Data are in mpeg video format. Samples were named by: 1. CEAMARC site (e.g. 16) 2. Instrument (e.g. camera = CAM) 3. Sequence of deployments through the survey overall (e.g. first deployment = 01; second deployment = 02) e.g. 09CAM05 is the fifth camera deployment of the survey overall, and was at CEAMARC site 09. Post-cruise analyses: 15 second logging of seabed geology and biology (species, class, order, whatever is significant for the habitat) directly into GNAV software for overlay into a GIS.

This database provides the most comprehensive systematic list of mega-epibenthic assemblages in the Australian Economic Exclusive Zone (AEEZ) of Heard Island and McDonalds Islands (HIMI) at water depths between 168 and 970 m. Data were collected to better understand the types and distribution of benthic invertebrates, their vulnerability to bottom fishing, and the effectiveness of the HIMI Marine Protected Area (MPA) for representing and protecting the regions benthic biodiversity. A total 504 taxa from 14 phyla were collected from 129 stations throughout HIMI. Two methods, beam trawl (for non-complex flat terrains) and epibenthic sled (for more complex, rough terrains), were used to sample the megabenthos. Both the trawl and sled were fitted with a 1 cm-2 mesh cod-end with a net opening (height x width) of 2.7 x 1.2 m for the beam trawl and 1.2 x 0.6 m for the epibenthic sled. Samples were sorted into broad taxonomic groups onboard the sampling vessel then frozen for later analysis. In the laboratory, samples were sieved over a 1 cm mesh and all dead material removed. Megabenthos were identified to the lowest possible taxonomic level by using the available literature and assistance of taxonomic specialists. All non-colonial taxa were counted and then weighed. Colonial taxa that could not be counted as individuals, e.g. demosponges and bryozoans, were separated to the lowest taxonomic level and a whole weight recorded per sample. Taxonomic expertise was provided by Dick Williams (Osteichthyes and Chondrichthyes) of the Australian Antarctic Division; Daphne Fautin and Andrea Crowther (Actinaria) of the University of Kansas; Cardin Wallace (Actinaria) from Queensland Museum; Elizabeth Turner (Bivalvia and Gastropoda) and Genefor Walker-Smith (Invertebrates) from the Tasmanian Museum and Art Gallery; Phillip Bock (Bryozoa), Mark Norman (Cephalopoda), Gary Poore (Crustacea), Joanne Taylor (Decapoda), Mark O'Loughlin (Holothuriodea), Jan Watson (Hydrozoa), Tim O'Hara (Ophiuroidea and Asteroidae), Robin Wilson (Polychaeta) and David Staples (Pycnogonida) of Museum Victoria; Igor Smirnov (Ophuroidea) of the University of Russia; and Andrew Hosie (Cirripedia) of the Western Australian Museum. A reference collection of the taxa is lodged at the Tasmanian Museum and Art Gallery, Hobart, Tasmania. On 2022-11-02 a minor data update was made to add scanned copies of old worksheets.

The RSV Aurora Australis V2 – Casey Resupply and Marine Science Voyage took place from 5 December 2014 to 25 January 2015. The voyage code is v2_201415020. The principal objective of the voyage was to undertake the Casey Resupply and then conduct marine science in the Dalton Polynya and near the Mertz Glacier. A downwards looking video camera system was fitted to the CTD and operated during most casts. The system was remotely controlled and typically operated only while the CTD was near the bottom although some videos show the complete descent through the water column. The video footage for each deployment was labelled as follows: VOYAGE_DATE_TIME_SITE.MTS Where: VOYAGE = v2_201415020 DATE = YYYY-MM-DD TIME = HHMMUTC (in 24 hr time) SITE = the CTD site name (e.g. SiteA5) Details on each site, including geographic coordinates and depth, are available in the Marine Data Voyage Report. The underway data from the voyage is available here: https://data.aad.gov.au/metadata/records/201415020