With the aim of estimating the proportion of Antarctic minke whales (Balaenoptera bonaerensis) in pack ice over summer, an Australian fixed-wing aerial survey programme, based in east Antarctica, was conducted in the austral summers of 2007/2008, 2008/09 and 2009/10 (See Kelly et al. 2010; SC/62/IA8). The first season (2007/08) comprised of three 'test' flights. As such, there were no real 'survey' data collected during these three flights, but video and digital stills data have been included in the dataset supplied. The surveys (2008/09 and 2009/10) covered two general regions: Vincennes Bay (66 degrees 24'S 110 degrees 18'E) which was surveyed multiple times across both seasons and within the 2009/10 season, and north and east of the Shackleton Ice Shelf and into the eastern section of the Davis Sea, which was surveyed once (2009/10). The primary focus was on Antarctic minke whales, however sightings of other species were also collected (killer whale, Southern right whale, penguins and seals). The survey was conducted in a CASA 212:400 aircraft at an altitude was 228m (750ft) and survey speed was 204 km/hr (110 knots). The survey was conducted as independent double-platform: the front and back observers were isolated visually and audibly. The aircraft was also fitted with a number of digital still, video and infrared cameras. Data Available 1. Sighting data set A .csv file of animal sightings. Two files, one for each survey season, has been supplied. The observers field of view was between 30 degrees and 60 degrees declination (approximately) from the horizon, corresponding to an on the ground area width of 264 metres each side of the aircraft. Protocol was followed as for traditional line transect surveys for marine mammals, with observers searching ahead of the aircraft in a 'D' pattern. The recorded observations consisted of cue counting (where possible) and the angle of declination when the animals were abeam to the observer (using a Suunto inclinometer). Cues were not recorded after the animals had moved past abeam. The angle of declination of groups was measured at the centre of the group. Perpendicular distance out to animals was calculated using angle of declination and flying height (but no correction for curvature of the earth or aircraft drift angle was applied). Other information recorded included species, group size (minimum, maximum and best estimate), cue type, number of animals at surface when perpendicular, direction of travel and any behavioural features of the animal(s). Please note that no formal sighting data was collected for the January 2008 test flights. 2. Effort data set A .csv file of survey effort and environmental conditions. Two files, one for each survey season, has been supplied. The flight leader recorded environmental covariates (ice coverage (to the nearest 10%), glare, Beaufort sea state, and cloud cover, etc) at regular intervals, or when conditions changed. 3. Still images The data includes jpeg files of images. A still camera was mounted vertically in the base of the aircraft to cover the trackline (10 megapixel Nikon D200 with 35mm lens); camera was situated behind a Perspex window. In addition in the final survey year (2009/10) two Nikon D300 cameras (12 megapixel with 50mm lens) were mounted at the side windows obliquely at an angle of 45 degrees (please note side-camera was used only during final season of survey, Dec 2009-Feb 2010). Focus set to infinity, and image settings given to account for high-light, high-contrast environments. GPS/altitude data was embedded in each images EXIF information. Still image coverage underneath the aircraft was uninterrupted along the trackline with a shutter-release of around 1 photograph per second and a swath width of around 157 m. Similarly the oblique mounted cameras had a coverage over 450 m each side of the trackline (i.e., configured to be approximately the same as the human observers). 4. Video cameras A number of streampix video files. Two high definition video cameras (Prosilica GC1350C GigE with 5mm F1.4 lens) were also fitted to the aircraft. Streampix is propriety software. 5. Infrared A number of .mov files recorded from an Infra-red camera (FLIR Photon 320 with 9mm lens) mounted in the base of the aircraft. Infrared camera was situated behind an infrared window. 6. Telemetry A number of text files (.txt) containing aircraft telemetry (yaw/roll etc) and gps. The telemetry is not that reliable, nor does it go anywhere close to covering all flights conducted (see below), but included for completeness. 7. Flight data 'dat' files dumped from the aircraft flight recorder containing flight data, including geographical position, velocity and altitude. These are ascii files. 8. GPS data In addition to flight and telemetry data, we've also included two post-processed GPS data files (two .csv files, one for each survey season). These files contain GPS data from a number of sources; this was to help buffer against GPS drop-outs. Therefore, this data is much more complete than the telemetry and flight data, and has been corrected for any time syncing issues. 9. "Season_overview_2010.xls" This Excel spreadsheet file contains details on each transect, effort and other sighting information. It accompanies the .csv files for the 2009/10 season as an overview. (A similar summary does not exist for 2008/09 season.)

On the return leg of the V1 2019 resupply voyage from Davis station to Hobart on the RSV Aurora Australis paired, open ocean environmental DNA (eDNA) samples were taken at 29 locations along the voyage. Sample names, sample coordinates as well as a range of environmental variables at each location are listed in file ‘V1 2019 Samples.xlsx’. Each sample pair consisted of one 2 L sample filtered through a 0.45 μm pore size filter, and one 12 L sample filtered through a 20 μm pore size filter. Filtering happened on board immediately after sampling. Filters of the 2 L samples were halved and stored in separate tubes, then immediately frozen at -80 ˚C. Filters of the 12 L samples were stored whole and also frozen at -80 ˚C. DNA of all samples was extracted at the specialised lab ‘eDNA frontiers’ located at Curtin University, WA using DNeasy Blood and Tissue Kits, and the extracted DNA sent back to the genetics lab at the Australian Antarctic Division (AAD). Several metabarcoding approaches were conducted to survey metazoan biodiversity present in these samples: - A marker targeting the mitochondrial gene cytochrome c oxidase I (COI) using metazoan specific primers (Forward primer mlCOIintF: GGWACWGGWTGAACWGTWTAYCCYCC; reverse primer jgHCO2198). This marker was used twice, using identical PCR conditions (95 °C for 10 min, a 16 cycle touchdown phase (62 °C -1 °C per cycle), followed by 25 cycles with an annealing temperature of 46 °C (total of 41 cycles), and a final extension at 72 °C for 5 min). : once using a two PCR step method, using MID tagged primers in the first round of PCR, and MID tagged Illumina sequencing adapters in the second round of PCR (second round PCR conditions using MID tagged Illumina sequencing adapters with this and all other markers listed below were: 95 °C for 10 min, 10 cycles of 95 °C for 30 sec, 55 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘COI dual tagged’. The second method used a one round PCR with fusion tagged primers, conducted at Curtin University and sequenced there as well. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘COI fusion tagged’. - A marker targeting the mitochondrial 16S rRNA gene, using fish specific primers (Forward primer Fish_F: GACGAGAAGACCCYRTGRAG; reverse primer Fish_R GACGAGAAGACCCYRTGRAG) with the following PCR conditions: 95 °C for 10 min, 45 cycles of 95 °C for 30 sec, 60 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. PCR were conducted in two steps as described above (first round PCR with MID tagged markers, second round PCR with MID tagged Illumina sequencing adapters). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Fish’. - A marker targeting the mitochondrial 16S rRNA gene, using mammal specific primers (Forward primer Mammal_F: CAATTTNGGTTGGGGTGA; reverse primer Mammal_R GGATTGCGCTGTTATCCCTA) with the following PCR conditions: 95 °C for 10 min, 45 cycles of 95 °C for 30 sec, 56 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. PCR were conducted in two steps as described above (first round PCR with MID tagged markers, second round PCR with MID tagged Illumina sequencing adapters). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Mammal’. - A marker targeting the mitochondrial 16S rRNA gene, using krill specific primers (Forward primer Crust_F: GTGACGATAAGACCCTATA; reverse primer Crust_R ATTACGCTGTTATCCCTAAAG) with the following PCR conditions: 95 °C for 10 min, 45 cycles of 95 °C for 30 sec, 56 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. PCR were conducted in two steps as described above (first round PCR with MID tagged markers, second round PCR with MID tagged Illumina sequencing adapters). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Krill’. Using the fish and mammal specific metabarcoding markers, we detected the presence of several fish and marine mammal species in a subset of eDNA samples. These markers were tested again with a number of additional markers: - A marker targeting the mitochondrial control region, using whale specific primers (Forward primer Dloop_1.5_F: CCACAGTACTATGTCCGTATT; Reverse primer Dlp4_R: GCGGGWTRYTGRTTTCACG) with the following first round PCR conditions: 95 °C for 10 min, 40 cycles of 95 °C for 30 sec, 54 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. First round markers were untagged. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Whale DLoop 1.5’. - A marker targeting the mitochondrial control region, using whale specific primers (Forward primer Dloop_10_F: TCACCCAAAGCTGRARTTCTA; Reverse primer Dlp4_R: GCGGGWTRYTGRTTTCACG) with the following first round PCR conditions: 95 °C for 10 min, 40 cycles of 95 °C for 30 sec, 54 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. First round markers were untagged. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Whale DLoop 10’. - A marker targeting the mitochondrial control region, using a nested PCR approach with whale specific primers (First round forward primer Dloop_1.5_F: CCACAGTACTATGTCCGTATT; Reverse primer Dloop_5_R: CCATCGWGATGTCTTATTTAAGRGGAA. Second round forward primer Dloop_1.5_F: CCACAGTACTATGTCCGTATT, reverse primer Dlp4_R: GCGGGWTRYTGRTTTCACG) with the following first round PCR conditions: 95 °C for 10 min, 40 cycles of 95 °C for 30 sec, 54 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min, and identical second round PCR conditions with the exception of only 20 cycles of amplification. First round markers as well as Illumina adaptors were MID tagged. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Whale DLoop Nested’. - A marker targeting the mitochondrial 16S rRNA gene using vertebra specific, MID tagged primers (Forward primer MarVer3_F: AGACGAGAAGACCCYRTG; reverse primer MarVer3_R: GGATTGCGCTGTTATCCC) with the following first round PCR conditions: 95 °C for 10 min, 40 cycles of 95 °C for 30 sec, 54 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Vertebra’.

This metadata record is a parent for all data collected during the 2013 Antarctic Blue Whale Voyage. Description of specific data sets can be found in the Voyage Science Plan and within child datasets.

We assembled tracking data from seabirds (n = 12 species) and marine mammals (n = 5 species), collected between 1991 and 2016, from across the Antarctic predator research community. See https://data.aad.gov.au/metadata/records/SCAR_EGBAMM_RAATD_2018_Standardised and https://data.aad.gov.au/metadata/records/SCAR_EGBAMM_RAATD_2018_Filtered for the tracking data. Habitat selectivity modelling was applied to these tracking data in order to identify the environmental characteristics important to each species, and to produce circum-Antarctic predictions of important geographic space for each individual species. The individual species maps were then combined to identify regions important to our full suite of species. This approach enabled us to account for incomplete tracking coverage (i.e., colonies from which no animals have been tracked) and to produce an integrated and spatially explicit assessment of areas of ecological importance across the Southern Ocean. The data attached to this metadata record include the single-species maps for Adelie, emperor, king, macaroni, and royal penguins; Antarctic and white-chinned petrels; black-browed, grey-headed, light-mantled, sooty, and wandering albatross; humpback whales; Antarctic fur seal, southern elephant seals, and crabeater and Weddell seals. The data also include the integrated maps that incorporate all species (weighted by colony size, and unweighted). See the paper and its supplementary information for full details on the modelling process and discussion of the model outputs.

Ship-based observations of whales sightings from the original 'ANARE Whale Log' books have been recovered into a single repository of sightings. ANARE (Australian National Antarctic Research Expeditions) is the historic acronym for these voyages. Currently there are data from 4 voyages, from the 1990's. Further data will be entered from existing Whale log datasheets on an ongoing basis. Observing platforms currently only include the ship, Aurora Australis. The quality and quantity of abiotic data associated with observations such as air temperature, sea ice cover etc vary immensely from voyage to voyage. Where possible these data have been entered. This dataset contains no information on estimates of survey effort and cannot be used to derive useful presence/absence spatial coverages of species during this period. It is purely sighting data only. Species distribution data are made available to SCAR-MarBIN (http://www.scarmarbin.be), OBIS and GBIF via the DiGIR protocol and Darwin Core schema.

This metadata record is a parent for all data on Antarctic blue whales collected during the 2015 New Zealand-Australia Antarctic Ecosystems Voyage. Description of specific data sets can be found in the Voyage Science Plan and within child datasets.

This dataset is a subset of the Wildlife on Voyage dataset, and comprises the wildlife observations made onboard the Aurora Australis on the IDIOTS cruise of 1999-2000. There were 45 observed species from 3222 observations. The technique used for collection was that prescribed by the Biological Investigation of Marine Antarctic Systems and Stocks (BIOMASS) Working Party on Bird Ecology. This work was incorporated into ASAC (AAS) projects 1101 and 2208. 1101 - Biology of the Mertz Glacier Polynya 2208 - Variability in the distribution and abundance of seabirds in the Southern Indian Ocean

Metadata record for data from ASAC Project 915 and 2253 See the link below for public details on these projects. Our cetacean research is conducted on multidisciplinary cruises aimed at investigating environmental change and ecosystem effects. Our research approach now integrates broad scale acoustic monitoring with fine scale ecology experiments during annual surveys with AMLR. These data will allow us to connect fine scale variability with regional and circum-Antarctic processes, and eventually to understand how the dynamics of the Antarctic ecosystem and environmental change might affect the recovery of whale populations. The BROKE WEST multidisciplinary survey to be held in the 2005/2006 season will provide a large-scale simultaneously collected dataset within which to analyse the cetacean distribution, ecological and acoustic data. These sightings were made on Australian Antarctic Division voyages. For further information about these voyages, see the URL given below. Codes provided in the download file for voyage come in two formats: V70102 - Voyage 7 of the 2001/2002 season KK0102 - Use of the Kapitan Khlebnikov by the Australian Antarctic Division in the 2001/2002 season. The download file will include an excel spreadsheet of sightings, resightings and incidental sightings, as well as an explanatory word document. For further details on methods used, and an explanation of the types of data collected, see the above mentioned word document. These data were collected as part of ASAC projects 915 and 2253 (ASAC_915 and ASAC_2253). The fields in this dataset are: Voyage Data Logger (Logger/Wincruz) Date Time Observer Method Bearing Distance (nautical miles) Swim Direction Near Ice Species Reaction Group Size Latitude Longitude

The Kerguelen Axis voyage was planned to collect data to enhance the realism of end-to-end ecosystem models being developed in the Antarctic Climate and Ecosystems Cooperative Research Centre, to investigate the effects of climate change and ocean acidification on Southern Ocean ecosystems in the Indian Sector (particularly in relation to factors affecting the northern distribution of Antarctic krill) and to contribute to assessment of the spatial relationship of mesopelagic mid-trophic level species, in particular zooplanktivores, to foraging strategies by marine mammals and birds on the Kerguelen Plateau. Nine projects were undertaken aboard the Aurora Australis. Each project had individual objectives and outputs, and there are metadata records for each data set collected. They were designed to be complementary in order that the whole data set and project analyses could be used to address the objectives of the Kerguelen Axis program. Observations will be contributed to the Southern Ocean Observing System (SOOS) and will facilitate the design of future ecosystem observing in the region.