General description: The associated file contains sediment pigment data from the antFOCE project 4127. Units: all pigment data in ug/g, 0 = below detection limit of HPLC. Sample collection details: At the start and end of the antFOCE experiment, four sediment core samples were taken from inside and outside each chamber or open plot by divers. The top 1 cm of the cores was then removed and placed in the dark, first at -20ºC for 2 hours, then at -80ºC until analysis at the Australian Antarctic division. Pigment analysis Frozen samples were transported under liquid N2 to a freeze drier (Dynavac, model FD-5), in pre-chilled flasks with a small amount of liquid N2 added. Custom made plumbing fitted to the freeze drier enabled samples to be purged with N2 to prevent photo-oxidation up until solvent extraction. Prior to pigment extraction five 2 g stainless steel ball bearings were added to homogenise the freeze dried sediment. The samples were bead beaten for 1 minute (Biospec products). Subsamples (~0.05 g) were immediately transferred to cryotubes with 700 µl of dimethylformamide (DMF) for two hours. Samples were kept at -80ºC and under a safe light (IFORD 902) at all times. All pigment concentrations are standardised to sediment weight. Pigments were extracted with dimethylformamide (DMF 700 µl) over a two hour period at -20ºC. Zirconia beads, and 100 µl of Apo 8 and an internal standard were added to each sub-sample. After a two hour extraction, sub-samples were bead beaten for 20 seconds and then placed in a centrifuge with filter cartridge inserts for 14 minutes at 2500 rpm at -9ºC to separate the solvent from the sediment. The supernatant was transferred into to a vial and placed in a precooled rpHPLC autosampler. The rpHPLC system used is described in Hodgson et al. (1997). Pigment detection was at 435, 470 and 665 nm for all chlorophylls and carotenoids, with spectra from 300–700 nm being collected every 0.2 seconds. Pigment identification was carried out using a combination of rpHPLC and normal phase HPLC retention times, light absorbance spectra and reference standards (see Hodgson et al., 1997). These techniques assisted in the accurate identification of pigments and their derivatives to a molecular level and enabled several pigment derivatives to be analysed. The HPLC was previously calibrated with authentic standards and protocols outlined in SCOR (1988). Data set headers: (A)Treatment: Example code 4127_SOP7_6-1-15_PlotB_R1, = prodject code_Standard Operating Procedure(SOP) used to collect samples(see antFOCE parent file)_ Date_Chamber/plot(A,B,C,D)_replicate core within Chamber/plot(1,2,3) (B) BB carot= BB caroten, type of pigment detected by HPLC. See Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more details. (C) Chl c1 = Chlorophyll derivatives see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (D) Chl c2 = Chlorophyll derivatives see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (E) Chl c3 = Chlorophyll derivative see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (F) Chla = Chlorophyll a see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (G) Ddx =Diadinoxanthin see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information (H) dtx = Diatoxanthin pigment. see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information (I) epi = Chlorophyll epimer pigment. see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (j) Fuc = Fucoxanthin pigment. see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (k) Gyro2 = Gyroxanthin pigment. see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (L) Pras = Prasanthin pigment. see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (m) Zea = Zeaxanthin pigment. see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (n) Date = Samples taken at the start of antFOCE experiment or at the end (o) chamber = The antFOCE chamber (A,B,C,D) (p) Treatment = The associated pH level in chambers (Acidified ~7.8, Control ~8.2) (Q) Position = Samples were taken within chambers and outside chambers (outside, inside) (r) rep= Subsamples were taken within each chamber/position (R1=replicate one, R1-R4) Spatial coordinates: 66.311500 S, 110.514216 E Dates: between 1/12/2014 and 1/3/2015 Timezone:UTC+11

Refer to antFOCE report section 4.4.5 for deployment, sampling and analysis details. https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 One camera and flash unit was mounted on the top middle section of each chamber to take one photo of the sediment every 30 minutes. The download file contains two folders with the photos taken from the 28th of January to the 23rd of February 2015 – one for Chamber A and one for Chamber C. A video time-lapse compilation of the Chamber A images is also included. Malfunctioning cameras deployed on Chamber A and C and on B and D during this same period and at other times, meant that no useful images were obtained. Background The antFOCE experimental system was deployed in O'Brien Bay, approximately 5 kilometres south of Casey station, East Antarctica, in the austral summer of 2014/15. Surface and sub-surface (in water below the sea ice) infrastructure allowed controlled manipulation of seawater pH levels (reduced by 0.4 pH units below ambient) in 2 chambers placed on the sea floor over natural benthic communities. Two control chambers (no pH manipulation) and two open plots (no chambers, no pH manipulation) were also sampled to compare to the pH manipulated (acidified) treatment chambers. Details of the antFOCE experiment can be found in the report – "antFOCE 2014/15 – Experimental System, Deployment, Sampling and Analysis". This report and a diagram indicating how the various antFOCE data sets relate to each other are available at: https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127

Metadata record AAS_4127_antFOCE_EnvironmentalData contains seafloor Ambient Light and ambient Seawater Temperature data sets collected at the antFOCE site during the experiment. Ambient Light data was collected using Photosynthetically Active Radiation sensors (Odyssey Dataflow 392 photo diode light meters) distributed around the antFOCE site as well as several inside the experimental chambers and open plots. Seawater Temperature data were collected using Onset Hoboware Tidbit v2 (UTBI-001) temperature loggers attached to the outside of various pieces of the underwater experimental infrastructure across the antFOCE site. Refer to antFOCE report section 2.3 for deployment, sampling and on-station analysis details. https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 Background The antFOCE experimental system was deployed in O'Brien Bay, approximately 5 kilometres south of Casey station, East Antarctica, in the austral summer of 2014/15. Surface and sub-surface (in water below the sea ice) infrastructure allowed controlled manipulation of seawater pH levels (reduced by 0.4 pH units below ambient) in 2 chambers placed on the sea floor over natural benthic communities. Two control chambers (no pH manipulation) and two open plots (no chambers, no pH manipulation) were also sampled to compare to the pH manipulated (acidified) treatment chambers. Details of the antFOCE experiment can be found in the report – "antFOCE 2014/15 – Experimental System, Deployment, Sampling and Analysis". This report and a diagram indicating how the various antFOCE data sets relate to each other are available at: https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127

Carbonate chemistry data for the antFOCE seawater samples. The download file contains an Excel spreadsheet with a number of worksheets detailing the samples collected from O'Brien Bay, Casey Station. The dataset includes information on oxygen levels, pH levels, temperature and salinity levels, as well as the concentrations of various elements (dissolved inorganic carbon, phosphate, nitrate, nitrite, silicate). Free-ocean CO2 enrichment (FOCE) experiments have been deployed in marine ecosystems to manipulate carbonate system conditions to those predicted in future oceans. We investigated whether the pH/carbonate chemistry of extremely cold polar waters can be manipulated in an ecologically relevant way, to represent conditions under future atmospheric CO2 levels, in an in-situ FOCE experiment in Antarctica. We examined spatial and temporal variation in local ambient carbonate chemistry at hourly intervals at two sites between December and February and compared these with experimental conditions. We successfully maintained a mean pH offset in acidified benthic chambers of -0.38 (plus or minus 0.07) from ambient for approximately 8 weeks. Local diel and seasonal fluctuations in ambient pH were duplicated in the FOCE system. Large temporal variability in acidified chambers resulted from system stoppages. The mean pH, Ωarag and fCO2 values in the acidified chambers were 7.688 plus or minus 0.079, 0.62 plus or minus 0.13 and 912 plus or minus 150 micro-atm respectively. Variation in ambient pH appeared to be mainly driven by salinity and biological production and ranged from 8.019 to 8.192 with significant spatio-temporal variation. This experiment demonstrates the utility of FOCE systems to create conditions expected in future oceans that represent ecologically relevant variation, even under polar conditions.

We use RNA sequencing to investigate which genetic/physiological pathways in Antarctic krill are affected by increased CO2 levels. We carried out larval CO2 exposure experiments in March 2012 at the AAD aquarium. Two developmental stages were used (Calyptopis I and Furcilia V) and three CO2 levels (control, 1000 and 2000 ppm). These were short term experiments (2 days) - since initial longer experiments starting with fertilized eggs resulted in differences in developmental stages between treatments and control which could confound the data. RNA was extracted from larvae and high-throughput RNA sequencing (RNA-seq) was carried out on 6 samples (2 stages * 3 treatments). Sequencing was carried out on an Illumina sequencer (Genome Analyzer II). We collected ~ 60 million sequence reads per sample (Data in FASTA format each read gives 100 base pairs of sequence), so a total of ~360 million reads (36 billion bp of data).

Refer to antFOCE report section 4.5.1 for deployment, sampling and analysis details. https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 The download file contains an Excel workbook with one data spreadsheet and one of notes relevant to the data. The data are the total number of each motile organism collected from 2 recruitment tiles deployed in chambers or open plots during the antFOCE experiment. The 2 tiles were deployed together in a metal stand in either a horizontal or vertical orientation. Background The antFOCE experimental system was deployed in O’Brien Bay, approximately 5 kilometres south of Casey station, East Antarctica, in the austral summer of 2014/15. Surface and sub-surface (in water below the sea ice) infrastructure allowed controlled manipulation of seawater pH levels (reduced by 0.4 pH units below ambient) in 2 chambers placed on the sea floor over natural benthic communities. Two control chambers (no pH manipulation) and two open plots (no chambers, no pH manipulation) were also sampled to compare to the pH manipulated (acidified) treatment chambers. Details of the antFOCE experiment can be found in the report – “antFOCE 2014/15 – Experimental System, Deployment, Sampling and Analysis”. This report and a diagram indicating how the various antFOCE data sets relate to each other are available at: https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127

Metadata record AAS_4127_antFOCE_HardSubstrateFauna contains all data sets relating to the fauna sampled from hard substrates during the antFOCE experiment, including recruitment tiles, artificial substrate units and biofilm slides. Refer to antFOCE report section 4.5 for deployment, sampling and on-station analysis details. https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 Background The antFOCE experimental system was deployed in O’Brien Bay, approximately 5 kilometres south of Casey station, East Antarctica, in the austral summer of 2014/15. Surface and sub-surface (in water below the sea ice) infrastructure allowed controlled manipulation of seawater pH levels (reduced by 0.4 pH units below ambient) in 2 chambers placed on the sea floor over natural benthic communities. Two control chambers (no pH manipulation) and two open plots (no chambers, no pH manipulation) were also sampled to compare to the pH manipulated (acidified) treatment chambers. Details of the antFOCE experiment can be found in the report – “antFOCE 2014/15 – Experimental System, Deployment, Sampling and Analysis”. This report and a diagram indicating how the various antFOCE data sets relate to each other are available at: https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127

This metadata record contains an Excel spreadsheet with Operational Taxonomic Units (OTUs) gained from 16S rRNA gene sequencing of prokaryotes sampled from Biofilm slides deployed as part of the antFOCE experiment in the austral summer of 2014/15 at Casey station, East Antarctica. Refer to antFOCE report section 4.5.3 for deployment, sampling and analysis details. https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 Sampling design 2 trays of 8 horizontal standard glass microscope slides (72 x 25 mm) per chamber. Four of the glass slides were scored with a diamond pencil approximately 18 mm from the right hand end of the slide and deployed scored side up. The remaining four slides were unmodified. Slides were sampled at: * Tmid - one tray per chamber / open plot. The sampled try was repopulated with fresh slides and redeployed * Tend – 2 slides trays per chamber / open plot. Sampling procedure After 31 days deployment, 1 slide tray per chamber / open plot was sampled. At Tend both trays in each chamber / open plot were sampled. To minimize disturbance while being raised to the surface, each tray was removed from the tray holder by divers and placed in a seawater filled container with a lid. On the surface, slides were removed from the tray using ethanol sterilized forceps. The four unscoured slides per chamber / open plot were placed in a plastic microscope slide holder with a sealable lid. The scoured slides were placed individually in 70 ml plastic sample jars. Lab procedure - Casey The slide holder (4 unscoured slides) from each chamber / open plot was frozen at -20C immediately upon return to the lab. The scoured slides were preserved in sea water containing 1% final concentration glutaraldehyde in separate jars. Preservation Issue: Scoured slides were not refrigerated, either at Casey, during RTA or in Kingston before the 26th Nov 2015, when they were transferred to the 4C Cold Store. antFOCE Background The antFOCE experimental system was deployed in O'Brien Bay, approximately 5 kilometres south of Casey station, East Antarctica, in the austral summer of 2014/15. Surface and sub-surface (in water below the sea ice) infrastructure allowed controlled manipulation of seawater pH levels (reduced by 0.4 pH units below ambient) in 2 chambers placed on the sea floor over natural benthic communities. Two control chambers (no pH manipulation) and two open plots (no chambers, no pH manipulation) were also sampled to compare to the pH manipulated (acidified) treatment chambers. Details of the antFOCE experiment can be found in the report – "antFOCE 2014/15 – Experimental System, Deployment, Sampling and Analysis". This report and a diagram indicating how the various antFOCE data sets relate to each other are available at: https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 High throughput sequencing of the 16S rRNA gene (Shane Powell) Genomic DNA samples were sequenced at the Ramaciotti Centre for Genomics at the University of New South Wales. The V4 region of the 16S rRNA gene was sequenced with the primers 515F – 806R on an Illumina MiSeq with MiSeq v2 reagent kit. Sequences were processed using MOTHUR v 1.36.1 (Schloss et al. 2009) following the suggested protocol for processing MiSeq datasets as described in Kozich et al. (2013) with the following modifications. The make.contigs command was used to join the paired-end reads from the fastaq files. Sequences that were longer than 300 bp or contained more than one ambiguous base were removed with the screen.seqs. Within each sample, exact duplicate sequences were merged with unique.seqs. The sequences were then aligned against the Silva database (downloaded March 1 2016). Sequences with 3 or less nucleotide differences in total were clustered together using pre.cluster. Potentially chimeric sequences were removed with the defaults settings of the MOTHUR implementation of uchime. After removal of chimeric sequences, the remaining sequences were grouped into operational taxonomic units (OTU) using cluster.split with taxlevel=4 (Order). Finally a table of the number of times each OTU appeared in each sample was generated with make.shared with a cut-off of 0.03 and the OTU were classified with classify.otu. As the sample with the fewest sequences contained 63955 sequences, rarefaction was carried out using the sub.sample command to randomly select 63 955 sequences per sample. A total of 4 604 760 sequences remained in the final OTU table. Any OTU that contained less than 500 sequences (less than 0.01%) were removed as potentially spurious or chimeric sequences, especially as these were generally unclassified sequences. Multivariate analyses were carried out using the PRIMER software. Data were standardised (converted to a percentage) prior to any other analysis.... Kozich, J.J., Westcott, S.L., Baxter, N.T., Highlander, S.K. and Schloss, P.D., 2013. Development of a dual-index sequencing strategy and curation pipeline for analyzing amplicon sequence data on the MiSeq Illumina sequencing platform. Applied and environmental microbiology 79:5112-5120. Schloss, P.D., Westcott, S.L., Ryabin, T., Hall, J.R., Hartmann, M., Hollister, E.B., Lesniewski, R.A., Oakley, B.B., Parks, D.H., Robinson, C.J. and Sahl, J.W., 2009. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Applied and environmental microbiology 75:7537-7541.

This metadata record contains an Excel spreadsheet with Operational Taxonomic Units (OTUs) gained from Eukaryotic 18S rDNA PCR amplification and high-throughput sequencing of samples from Biofilm slides deployed as part of the antFOCE experiment in the austral summer of 2014/15 at Casey station, East Antarctica. Refer to antFOCE report section 4.5.3 for deployment, sampling and analysis details. https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 Sampling design 2 trays of 8 horizontal standard glass microscope slides (72 x 25 mm) per chamber. Four of the glass slides were scored with a diamond pencil approximately 18 mm from the right hand end of the slide and deployed scored side up. The remaining four slides were unmodified. Slides were sampled at: - Tmid - one tray per chamber / open plot. The sampled try was repopulated with fresh slides and redeployed - Tend – 2 slides trays per chamber / open plot. Sampling procedure After 31 days deployment, 1 slide tray per chamber / open plot was sampled. At Tend both trays in each chamber / open plot were sampled. To minimize disturbance while being raised to the surface, each tray was removed from the tray holder by divers and placed in a seawater filled container with a lid. On the surface, slides were removed from the tray using ethanol sterilized forceps. The four unscoured slides per chamber / open plot were placed in a plastic microscope slide holder with a sealable lid. The scoured slides were placed individually in 70 ml plastic sample jars. Lab procedure - Casey The slide holder (4 unscoured slides) from each chamber / open plot was frozen at -20C immediately upon return to the lab. The scoured slides were preserved in sea water containing 1% final concentration glutaraldehyde in separate jars. Preservation Issue: Scoured slides were not refrigerated, either at Casey, during RTA or in Kingston before the 26th Nov 2015, when they were transferred to the 4C Cold Store. antFOCE Background The antFOCE experimental system was deployed in O’Brien Bay, approximately 5 kilometres south of Casey station, East Antarctica, in the austral summer of 2014/15. Surface and sub-surface (in water below the sea ice) infrastructure allowed controlled manipulation of seawater pH levels (reduced by 0.4 pH units below ambient) in 2 chambers placed on the sea floor over natural benthic communities. Two control chambers (no pH manipulation) and two open plots (no chambers, no pH manipulation) were also sampled to compare to the pH manipulated (acidified) treatment chambers. Details of the antFOCE experiment can be found in the report – "antFOCE 2014/15 – Experimental System, Deployment, Sampling and Analysis". This report and a diagram indicating how the various antFOCE data sets relate to each other are available at: https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 AntFOCE biofilm DNA methods Laurence Clarke, Shane Powell, Bruce Deagle DNA extraction The biofilm was removed from the top of each slide with a cotton swab and DNA extracted directly from the swab using the MoBio PowerBiofilm DNA isolation kit following the manufacturer’s protocol. Extraction blanks were extracted in parallel to detect contamination. Eukaryotic 18S rDNA PCR amplification and high-throughput sequencing DNA extracts were PCR-amplified in triplicate with primers designed to amplify 140-170 bp of eukaryotic 18S ribosomal DNA (Jarman et al. 2013). The forward primer was modified to improve amplification of protists. Table 1. First and second round primers, including MID tags (Xs). ILF_ProSSU3'F_X TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG XXXXXX CACCGCCCGTCGCWMCTACCG ILR_SSU3'R_Y GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG XXXXXX GGTTCACCTACGGAAACCTTGTTACG msqFX AATGATACGGCGACCACCGAGATCTACAC XXXXXXXXXX TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG msqRY CAAGCAGAAGACGGCATACGAGAT XXXXXXXXXX GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG PCR amplifications were performed in two rounds, the first to amplify the 18S region and add sample-specific multiplex-identifier (MID) tags and Illumina sequencing primers, the second to add the P5 and P7 sequencing adapters and additional MIDs. Each reaction mix for the first PCR contained 0.1 µM each of forward and reverse primer, 0.2 µg/µL BSA, 0.2 U Phusion DNA polymerase in 1 x Phusion Master Mix (New England Biolabs, Ipswich, MA, USA) and 1 micro L DNA extract in a total reaction volume of 10 micro L. PCR thermal cycling conditions were initial denaturation at 98 degrees C for 30 secs, followed by 25 cycles of 98 degrees C for 5 secs, 67 degrees C for 20 secs and 72 degrees C for 20 secs, with a final extension at 72 degrees C for 5 min. Replicate PCR products were pooled then diluted 1:10 and Illumina sequencing adapters added in a second round of PCR using the same reaction mix and thermal cycling conditions as the first round, except the concentration of BSA was halved (0.1 micro g/micro L), and the number of cycles was reduced to 10 with an annealing temperature of 55 degrees C. Products from each round of PCR were visualized on 2% agarose gels. Second round PCR products were pooled in equimolar ratios based on band intensity. The pooled products were purified using Agencourt AMPure XP beads (Beckman Coulter, Brea, CA, USA) and the concentration of the library measured using the Qubit dsDNA HS assay on a QUBIT 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA). The pool was diluted to 2 nM and paired-end reads generated on a MiSeq (Illumina, San Diego, CA, USA) with MiSeq Reagent Nano kit vs (300-cycles). Bacterial 16S rDNA PCR amplification and high-throughput sequencing Bioinformatics Reads were sorted by sample-specific MIDs added in the second round PCR using the MiSeq Reporter software. Fastq reads were merged using the -fastq_mergepairs command in USEARCH v8.0.1623 (Edgar 2010). Merged reads were sorted by "internal" 6 bp MID tags, and locus-specific primers trimmed with custom R scripts using the ShortRead package (Morgan et al. 2009), with only reads containing perfect matches to the expected MIDs and primers retained. Reads for all samples were dereplicated and global singletons discarded (-derep_fulllength -minuniquesize 2), and clustered into OTUs with the UPARSE algorithm (Edgar 2013) using the '-cluster_otus' command. Potentially chimeric reads were also discarded during this step. Reads for each sample were then assigned to OTUs (-usearch_global -id .97), and an OTU table generated using a custom R script. Taxonomy was assigned to each OTU using MEGAN version 5.10.5 (Huson et al. 2011) based on 50 hits per OTU generated by BLASTN searches against the NCBI 'nt' database (downloaded August 2015). Default LCA parameters were used, except Min support = 1, Min score = 100, Top percent = 10. Alpha and beta-diversity analyses were performed based on a rarefied OTU table with QIIME v1.8.0 (alpha_rarefaction.py, beta_diversity_through_plots.py, Caporaso et al. 2010). References Caporaso JG, Kuczynski J, Stombaugh J, et al. (2010) QIIME allows analysis of high-throughput community sequencing data. Nature Methods 7, 335-336. Huson DH, Mitra S, Ruscheweyh HJ, Weber N, Schuster SC (2011) Integrative analysis of environmental sequences using MEGAN4. Genome Research 21, 1552-1560. Jarman SN, McInnes JC, Faux C, et al. (2013) Adelie penguin population diet monitoring by analysis of food DNA in scats. PLoS One 8, e82227.

Refer to antFOCE report section 4.5.1 for deployment, sampling and analysis details. https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 The download file contains an Excel workbook with one data spreadsheet and one of notes relevant to the data. The data are the total number of each sessile organism collected per tile as per the census methods detailed in the Notes spreadsheet. Tiles were deployed in chambers or open plots during the antFOCE experiment on a metal stand in either a horizontal or vertical orientation. Background The antFOCE experimental system was deployed in O’Brien Bay, approximately 5 kilometres south of Casey station, East Antarctica, in the austral summer of 2014/15. Surface and sub-surface (in water below the sea ice) infrastructure allowed controlled manipulation of seawater pH levels (reduced by 0.4 pH units below ambient) in 2 chambers placed on the sea floor over natural benthic communities. Two control chambers (no pH manipulation) and two open plots (no chambers, no pH manipulation) were also sampled to compare to the pH manipulated (acidified) treatment chambers. Details of the antFOCE experiment can be found in the report – “antFOCE 2014/15 – Experimental System, Deployment, Sampling and Analysis”. This report and a diagram indicating how the various antFOCE data sets relate to each other are available at: https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127